Morpholino

MO2-lmln

ID

ZDB-MRPHLNO-130918-3

Name

MO2-lmln

Previous Names

Target

Sequence

5' - TCCTTAAATATCTCCGTTACCTGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lmln

No data available

Phenotype

Phenotype resulting from MO2-lmln

Phenotype	Fish	Figures
hatching decreased occurrence, abnormal	WT + MO2-lmln	Fig. 3 from Vass et al., 2013
intersegmental vessel decreased size, abnormal	y1Tg + MO2-lmln	Fig. 6 from Vass et al., 2013
melanocyte dispersed, abnormal	WT + MO2-lmln	Fig. 4 from Vass et al., 2013
melanocyte spatial pattern, abnormal	WT + MO2-lmln	Fig. 4 from Vass et al., 2013
neuromast decreased amount, abnormal	WT + MO2-lmln	Fig. 3 from Vass et al., 2013
neuromast deposition disrupted, abnormal	WT + MO2-lmln	Fig. 3 from Vass et al., 2013
parachordal vessel decreased size, abnormal	y1Tg + MO2-lmln	Fig. 6 from Vass et al., 2013
sprouting angiogenesis disrupted, abnormal	y1Tg + MO2-lmln	Fig. 6 from Vass et al., 2013
vasculature development disrupted, abnormal	sd2Tg; y1Tg + MO2-lmln	Fig. 7 from Vass et al., 2013
whole organism dead, abnormal	WT + MO2-lmln	Fig. 3 from Vass et al., 2013
whole organism viability, abnormal	WT + MO2-lmln	Fig. 3 from Vass et al., 2013

Phenotype of all Fish created by or utilizing MO2-lmln

Phenotype	Fish	Conditions	Figures
neuromast decreased amount, abnormal	WT + MO2-lmln	standard conditions	Fig. 3 from Vass et al., 2013
whole organism dead, abnormal	WT + MO2-lmln	standard conditions	Fig. 3 from Vass et al., 2013
hatching decreased occurrence, abnormal	WT + MO2-lmln	standard conditions	Fig. 3 from Vass et al., 2013
whole organism viability, abnormal	WT + MO2-lmln	standard conditions	Fig. 3 from Vass et al., 2013
neuromast deposition disrupted, abnormal	WT + MO2-lmln	standard conditions	Fig. 3 from Vass et al., 2013
melanocyte spatial pattern, abnormal	WT + MO2-lmln	standard conditions	Fig. 4 from Vass et al., 2013
melanocyte dispersed, abnormal	WT + MO2-lmln	standard conditions	Fig. 4 from Vass et al., 2013
parachordal vessel decreased size, abnormal	y1Tg + MO2-lmln	standard conditions	Fig. 6 from Vass et al., 2013
intersegmental vessel decreased size, abnormal	y1Tg + MO2-lmln	standard conditions	Fig. 6 from Vass et al., 2013
sprouting angiogenesis disrupted, abnormal	y1Tg + MO2-lmln	standard conditions	Fig. 6 from Vass et al., 2013
vasculature development disrupted, abnormal	sd2Tg; y1Tg + MO2-lmln	standard conditions	Fig. 7 from Vass et al., 2013

Citations