Morpholino

MO2-pip4k2aa

ID
ZDB-MRPHLNO-130801-3
Name
MO2-pip4k2aa
Previous Names
  • ATGMO zPIP4Ka (1)
Target
Sequence
5' - ACAGTGTTACTAGCCGAGGCCATTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pip4k2aa
Expressed Gene Anatomy Figures
lmo2 Fig. S7 with image from Stijf-Bultsma et al., 2015
mespaa Fig. 7 with image from Stijf-Bultsma et al., 2015
pip4k2aa Fig. 2,  Fig. 5 from Elouarrat et al., 2013
tal1 Fig. S7 with image from Stijf-Bultsma et al., 2015
Phenotype
Phenotype resulting from MO2-pip4k2aa
Phenotype Fish Figures
1-phosphatidylinositol-4-phosphate 5-kinase activity decreased occurrence, abnormal WT + MO2-pip4k2aa Fig. 5 from Elouarrat et al., 2013
embryo development disrupted, abnormal WT + MO2-pip4k2aa + MO4-tp53 Fig. 2,  Fig. 3,  Fig. 4 from Elouarrat et al., 2013
eye malformed, abnormal WT + MO2-pip4k2aa Fig. 3 from Elouarrat et al., 2013
hatching process quality, abnormal WT + MO2-pip4k2aa Fig. S7 with image from Stijf-Bultsma et al., 2015
head decreased size, abnormal WT + MO2-pip4k2aa Fig. 3 from Elouarrat et al., 2013
pericardium edematous, abnormal WT + MO2-pip4k2aa Fig. 2,  Fig. 3,  Fig. 4 from Elouarrat et al., 2013
somite morphology, abnormal WT + MO2-pip4k2aa Fig. S7 with image from Stijf-Bultsma et al., 2015
Fig. 3 from Elouarrat et al., 2013
somite skeletal muscle myofibril disorganized, abnormal WT + MO2-pip4k2aa Fig. S7 with image from Stijf-Bultsma et al., 2015
swimming behavior disrupted, abnormal WT + MO2-pip4k2aa text only from Elouarrat et al., 2013
whole organism tal1 expression decreased amount, abnormal WT + MO2-pip4k2aa Fig. S7 with image from Stijf-Bultsma et al., 2015
whole organism lmo2 expression decreased amount, abnormal WT + MO2-pip4k2aa Fig. S7 with image from Stijf-Bultsma et al., 2015
whole organism mespaa expression decreased amount, abnormal WT + MO2-pip4k2aa Fig. 7 with image from Stijf-Bultsma et al., 2015
whole organism increased curvature, abnormal WT + MO2-pip4k2aa Fig. 3,  Fig. 4 from Elouarrat et al., 2013
whole organism morphology, abnormal WT + MO2-pip4k2aa Fig. 2 from Elouarrat et al., 2013
whole organism viability, abnormal WT + MO2-pip4k2aa text only from Elouarrat et al., 2013
Phenotype of all Fish created by or utilizing MO2-pip4k2aa
Phenotype Fish Conditions Figures
eye malformed, abnormal WT + MO2-pip4k2aa standard conditions Fig. 3 from Elouarrat et al., 2013
pericardium edematous, abnormal WT + MO2-pip4k2aa standard conditions Fig. 2,  Fig. 3,  Fig. 4 from Elouarrat et al., 2013
whole organism morphology, abnormal WT + MO2-pip4k2aa standard conditions Fig. 2 from Elouarrat et al., 2013
head decreased size, abnormal WT + MO2-pip4k2aa standard conditions Fig. 3 from Elouarrat et al., 2013
somite skeletal muscle myofibril disorganized, abnormal WT + MO2-pip4k2aa standard conditions Fig. S7 with image from Stijf-Bultsma et al., 2015
whole organism increased curvature, abnormal WT + MO2-pip4k2aa standard conditions Fig. 3,  Fig. 4 from Elouarrat et al., 2013
whole organism mespaa expression decreased amount, abnormal WT + MO2-pip4k2aa standard conditions Fig. 7 with image from Stijf-Bultsma et al., 2015
swimming behavior disrupted, abnormal WT + MO2-pip4k2aa standard conditions text only from Elouarrat et al., 2013
whole organism tal1 expression decreased amount, abnormal WT + MO2-pip4k2aa standard conditions Fig. S7 with image from Stijf-Bultsma et al., 2015
somite morphology, abnormal WT + MO2-pip4k2aa standard conditions Fig. S7 with image from Stijf-Bultsma et al., 2015
Fig. 3 from Elouarrat et al., 2013
1-phosphatidylinositol-4-phosphate 5-kinase activity decreased occurrence, abnormal WT + MO2-pip4k2aa standard conditions Fig. 5 from Elouarrat et al., 2013
embryo development disrupted, abnormal WT + MO2-pip4k2aa standard conditions Fig. 2,  Fig. 3,  Fig. 4 from Elouarrat et al., 2013
whole organism lmo2 expression decreased amount, abnormal WT + MO2-pip4k2aa standard conditions Fig. S7 with image from Stijf-Bultsma et al., 2015
whole organism viability, abnormal WT + MO2-pip4k2aa standard conditions text only from Elouarrat et al., 2013
hatching process quality, abnormal WT + MO2-pip4k2aa standard conditions Fig. S7 with image from Stijf-Bultsma et al., 2015
whole organism morphology, abnormal WT + MO2-pip4k2aa + MO4-tp53 standard conditions Fig. 2 from Elouarrat et al., 2013
pericardium edematous, abnormal WT + MO2-pip4k2aa + MO4-tp53 standard conditions Fig. 2 from Elouarrat et al., 2013
embryo development disrupted, abnormal WT + MO2-pip4k2aa + MO4-tp53 standard conditions Fig. 2 from Elouarrat et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.