Morpholino

MO2-rer1

ID
ZDB-MRPHLNO-130412-2
Name
MO2-rer1
Previous Names
  • SMO (1)
Target
Sequence
5' - CCACCCCTAATACAAACAAACAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rer1
Expressed Gene Anatomy Figures
dla Fig. 5 from Jurisch-Yaksi et al., 2013
dnah9 Fig. 5 from Jurisch-Yaksi et al., 2013
foxj1a Fig. 5 from Jurisch-Yaksi et al., 2013
notch1a Fig. 5 from Jurisch-Yaksi et al., 2013
notch3 Fig. 5 from Jurisch-Yaksi et al., 2013
rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
Phenotype
Phenotype resulting from MO2-rer1
Phenotype Fish Figures
anterior lateral line neuromast cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
cilium assembly disrupted, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
detection of light stimulus involved in visual perception decreased process quality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased size, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
fluid transport disrupted, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
heart looping process quality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium movement quality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
macula cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
neuromast decreased amount, abnormal AB + MO2-rer1 Fig. 5 from Jurisch-Yaksi et al., 2013
olfactory pit cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
optokinetic behavior disrupted, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage morphology, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage chondrocyte decreased amount, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
posterior lateral line neuromast hair cell decreased amount, abnormal sqet4Et + MO2-rer1 Fig. 5 from Jurisch-Yaksi et al., 2013
pronephros cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
retina decreased functionality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
retinal cone cell decreased amount, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
retinal rod cell decreased amount, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
Phenotype of all Fish created by or utilizing MO2-rer1
Phenotype Fish Conditions Figures
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
cilium assembly disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
optokinetic behavior disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased size, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
retinal cone cell decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
neuromast decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 5 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
macula cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
anterior lateral line neuromast cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium movement quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
heart looping process quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage morphology, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
retina decreased functionality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage chondrocyte decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
fluid transport disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
retinal rod cell decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
pronephros cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
olfactory pit cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
detection of light stimulus involved in visual perception decreased process quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
posterior lateral line neuromast hair cell decreased amount, abnormal sqet4Et + MO2-rer1 standard conditions Fig. 5 from Jurisch-Yaksi et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.