Morpholino
MO3-wtip
- ID
- ZDB-MRPHLNO-130118-1
- Name
- MO3-wtip
- Previous Names
-
- wtipMOex2 (1)
- Target
- Sequence
-
5' - TGTATTTGTAGAAACTCACCGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-wtip
No data available
Phenotype
Phenotype resulting from MO3-wtip
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO3-wtip
1 - 5 of 12 Show all
Citations
- De Jong, H.N., Dewey, F.E., Cordero, P., Victorio, R.A., Kirillova, A., Huang, Y., Madhvani, R., Seo, K., Werdich, A.A., Lan, F., Orcholski, M., Robert Liu, W., Erbilgin, A., Wheeler, M.T., Chen, R., Pan, S., Kim, Y.M., Bommakanti, K., Marcou, C.A., Martijn Bos, J., Haddad, F., Ackerman, M., Vasan, R.S., MacRae, C., Wu, J.C., de Jesus Perez, V., Snyder, M., Parikh, V.N., Ashley, E.A. (2022) Wnt Signaling Interactor WTIP (Wilms Tumor Interacting Protein) Underlies Novel Mechanism for Cardiac Hypertrophy. Circulation. Genomic and precision medicine. 15(4):e003563
- Bubenshchikova, E., Ichimura, K., Fukuyo, Y., Powell, R., Hsu, C., Morrical, S.O., Sedor, J.R., Sakai, T., and Obara, T. (2012) Wtip and Vangl2 are required for mitotic spindle orientation and cloaca morphogenesis. Biology Open. 1(6):588-596
1 - 2 of 2
Show