Morpholino

MO3-spg11

ID
ZDB-MRPHLNO-121220-3
Name
MO3-spg11
Previous Names
None
Target
Sequence
5' - ACCAATCATAGCGTCTCGTACCCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spg11
No data available
Phenotype
Phenotype resulting from MO3-spg11
Phenotype Fish Figures
eye decreased size, abnormal AB + MO3-spg11 Fig. 2 from Martin et al., 2012
head decreased size, abnormal AB + MO3-spg11 Fig. 2 from Martin et al., 2012
motor neuron axon branchiness, abnormal zf532Tg + MO3-spg11 Fig. 4 from Martin et al., 2012
motor neuron axon truncated, abnormal zf532Tg + MO3-spg11 Fig. 4 from Martin et al., 2012
motor neuron axon guidance process quality, abnormal zf532Tg + MO3-spg11 Fig. 4 from Martin et al., 2012
post-vent region deformed, abnormal AB + MO3-spg11 Fig. 2 from Martin et al., 2012
post-vent region increased curvature, abnormal AB + MO3-spg11 Fig. 2 from Martin et al., 2012
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal zf532Tg + MO3-spg11 Fig. 4 from Martin et al., 2012
swimming behavior disrupted, abnormal AB + MO3-spg11 Fig. S2 from Martin et al., 2012
telencephalon Ab1-GM2 labeling increased amount, abnormal WT + MO3-spg11 Fig. 6 with image from Boutry et al., 2018
thigmotaxis disrupted, abnormal AB + MO3-spg11 Fig. S2 from Martin et al., 2012
thigmotaxis process quality, abnormal WT + MO3-spg11 Fig. 6 with image from Boutry et al., 2018
whole organism decreased mobility, abnormal WT + MO3-spg11 Fig. 6 with image from Boutry et al., 2018
whole organism paralysed, abnormal WT + MO3-spg11 Fig. 6 with image from Boutry et al., 2018
Phenotype of all Fish created by or utilizing MO3-spg11
Phenotype Fish Conditions Figures
swimming behavior disrupted, abnormal AB + MO3-spg11 standard conditions Fig. S2 from Martin et al., 2012
head decreased size, abnormal AB + MO3-spg11 standard conditions Fig. 2 from Martin et al., 2012
post-vent region deformed, abnormal AB + MO3-spg11 standard conditions Fig. 2 from Martin et al., 2012
eye decreased size, abnormal AB + MO3-spg11 standard conditions Fig. 2 from Martin et al., 2012
post-vent region increased curvature, abnormal AB + MO3-spg11 standard conditions Fig. 2 from Martin et al., 2012
thigmotaxis disrupted, abnormal AB + MO3-spg11 standard conditions Fig. S2 from Martin et al., 2012
whole organism mobility, ameliorated WT + MO3-spg11 chemical treatment by environment: miglustat Fig. 6 with image from Boutry et al., 2018
whole organism decreased mobility, abnormal WT + MO3-spg11 standard conditions Fig. 6 with image from Boutry et al., 2018
thigmotaxis process quality, ameliorated WT + MO3-spg11 chemical treatment by environment: miglustat Fig. 6 with image from Boutry et al., 2018
telencephalon Ab1-GM2 labeling increased amount, abnormal WT + MO3-spg11 standard conditions Fig. 6 with image from Boutry et al., 2018
whole organism paralysed, abnormal WT + MO3-spg11 standard conditions Fig. 6 with image from Boutry et al., 2018
thigmotaxis process quality, abnormal WT + MO3-spg11 standard conditions Fig. 6 with image from Boutry et al., 2018
telencephalon Ab1-GM2 labeling amount, ameliorated WT + MO3-spg11 chemical treatment by environment: miglustat Fig. 6 with image from Boutry et al., 2018
motor neuron axon truncated, abnormal zf532Tg + MO3-spg11 standard conditions Fig. 4 from Martin et al., 2012
motor neuron axon guidance process quality, abnormal zf532Tg + MO3-spg11 standard conditions Fig. 4 from Martin et al., 2012
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal zf532Tg + MO3-spg11 standard conditions Fig. 4 from Martin et al., 2012
motor neuron axon branchiness, abnormal zf532Tg + MO3-spg11 standard conditions Fig. 4 from Martin et al., 2012
eye decreased size, abnormal AB + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 3 from Martin et al., 2012
swimming behavior disrupted, abnormal AB + MO2-zfyve26 + MO3-spg11 standard conditions Fig. S3 from Martin et al., 2012
post-vent region deformed, abnormal AB + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 3 from Martin et al., 2012
post-vent region kinked, abnormal AB + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 3 from Martin et al., 2012
post-vent region decreased length, abnormal AB + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 3 from Martin et al., 2012
thigmotaxis disrupted, abnormal AB + MO2-zfyve26 + MO3-spg11 standard conditions Fig. S3 from Martin et al., 2012
motor neuron axon guidance process quality, abnormal zf532Tg + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 5 from Martin et al., 2012
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal zf532Tg + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 5 from Martin et al., 2012
neuromuscular junction development disrupted, abnormal zf532Tg + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 5 from Martin et al., 2012
motor neuron axon truncated, abnormal zf532Tg + MO2-zfyve26 + MO3-spg11 standard conditions Fig. 5 from Martin et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.