Morpholino

MO2-itga6a

ID
ZDB-MRPHLNO-121219-5
Name
MO2-itga6a
Previous Names
None
Target
Sequence
5' - CTGTTGTATGAAAAATATAGCCCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-itga6a
No data available
Phenotype
Phenotype resulting from MO2-itga6a
No data available
Phenotype of all Fish created by or utilizing MO2-itga6a
Phenotype Fish Conditions Figures
vertical myoseptum malformed, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 7 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with imageFig. 7 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome decreased width, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
whole organism decreased length, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with imageFig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal lamc1wi390Tg/wi390Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
trunk decreased length, abnormal lamc1wi390Tg/wi390Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
post-vent region decreased length, abnormal lamc1wi390Tg/wi390Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 4 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal mai1Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 7 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal mai1Tg + MO1-itga6a + MO2-itga6a standard conditions Fig. 7 with image from Goody et al., 2012
Citations