Morpholino
MO1-ccl19a.1
- ID
- ZDB-MRPHLNO-121213-2
- Name
- MO1-ccl19a.1
- Previous Names
-
- MO1-ccl19.1 (1)
- Target
- Sequence
-
5' - TCTGGAGAAGCTAGAAGAGTGTTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccl19a.1
Expressed Gene | Anatomy | Figures |
---|---|---|
dharma |
Fig. 6
from Wu et al., 2012 |
|
dusp6 |
Fig. 6
from Wu et al., 2012 |
|
gsc |
Fig. 6
from Wu et al., 2012 |
|
szl |
Fig. 6
from Wu et al., 2012 |
|
ved |
Fig. 6
from Wu et al., 2012 |
Phenotype
Phenotype resulting from MO1-ccl19a.1
Phenotype | Fish | Figures |
---|---|---|
whole organism wholly dorsalized, abnormal | WT + MO1-ccl19a.1 |
Fig. 6
from Wu et al., 2012 |
Phenotype of all Fish created by or utilizing MO1-ccl19a.1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism wholly dorsalized, abnormal | WT + MO1-ccl19a.1 | standard conditions |
Fig. 6
from Wu et al., 2012 |
whole organism wholly dorsalized, abnormal | WT + MO1-ccl19a.1 + MO2-ccr7 | standard conditions |
Fig. 6
from Wu et al., 2012 |
Citations