Morpholino
MO3-lpar3
- ID
- ZDB-MRPHLNO-121114-5
- Name
- MO3-lpar3
- Previous Names
-
- tMO2 (1)
- Target
- Sequence
-
5' - TAGCAGATGTTGTGCCTGGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lpar3
No data available
Phenotype
Phenotype resulting from MO3-lpar3
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO3-lpar3
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
nucleate erythrocyte absent, abnormal | WT + MO3-lpar3 | standard conditions |
Fig. 1
from Chiang et al., 2011 |
erythrocyte differentiation disrupted, abnormal | WT + MO3-lpar3 | standard conditions |
Fig. 1,
Fig. S2
from Chiang et al., 2011 |
1 - 2 of 2
Citations
- Lai, S.L., Yao, W.L., Tsao, K.C., Houben, A.J., Albers, H.M., Ovaa, H., Moolenaar, W.H., and Lee, S.J. (2012) Autotaxin/Lpar3 signaling regulates Kupffer's vesicle formation and left-right asymmetry in zebrafish. Development (Cambridge, England). 139(23):4439-4448
- Chiang, C.L., Chen, S.S., Lee, S.J., Tsao, K.C., Chu, P.L., Wen, C.H., Hwang, S.M., Yao, C.L., and Lee, H. (2011) LPA Induces Erythropoiesis through Activating Lysophosphatidic Acid Receptor 3. Stem cells (Dayton, Ohio). 29(11):1763-73
1 - 2 of 2
Show