Morpholino

MO3-dpysl2b

ID
ZDB-MRPHLNO-121029-1
Name
MO3-dpysl2b
Previous Names
None
Target
Sequence
5' - CTTCTTGCCCTGATAGCCAGACATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dpysl2b
No data available
Phenotype
Phenotype resulting from MO3-dpysl2b
Phenotype Fish Figures
anterior commissure axon decreased distribution, abnormal RW + MO3-dpysl2b Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO3-dpysl2b Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
branchiomotor neuron neuron migration disrupted, abnormal rw0Tg + MO3-dpysl2b Fig. 3 from Fiallos-Oliveros et al., 2020
CaP motoneuron mislocalised, abnormal RW + MO3-dpysl2b Fig. 2 from Suzuki et al., 2022
postoptic commissure axon decreased distribution, abnormal RW + MO3-dpysl2b Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO3-dpysl2b Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
retinal neural layer axon decreased branchiness, abnormal WT + MO3-dpysl2b Fig. 2 with image from Liu et al., 2018
retinal neural layer axon truncated, abnormal WT + MO3-dpysl2b Fig. 2 with image from Liu et al., 2018
rhombomere 6 branchiomotor neuron displaced to rhombomere 5, abnormal rw0Tg + MO3-dpysl2b Fig. 3 from Fiallos-Oliveros et al., 2020
rhombomere 6 branchiomotor neuron displaced to rhombomere 4, abnormal rw0Tg + MO3-dpysl2b Fig. 3 from Fiallos-Oliveros et al., 2020
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO3-dpysl2b Fig. 1 with image from Tanaka et al., 2012
Phenotype of all Fish created by or utilizing MO3-dpysl2b
Phenotype Fish Conditions Figures
CaP motoneuron mislocalised, abnormal RW + MO3-dpysl2b control Fig. 2 from Suzuki et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO3-dpysl2b control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
postoptic commissure axon decreased distribution, abnormal RW + MO3-dpysl2b control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
anterior commissure axon decreased distribution, abnormal RW + MO3-dpysl2b control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO3-dpysl2b control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
retinal neural layer axon decreased branchiness, abnormal WT + MO3-dpysl2b standard conditions Fig. 2 with image from Liu et al., 2018
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO3-dpysl2b standard conditions Fig. 1 with image from Tanaka et al., 2012
retinal neural layer axon truncated, abnormal WT + MO3-dpysl2b standard conditions Fig. 2 with image from Liu et al., 2018
rhombomere 6 branchiomotor neuron displaced to rhombomere 5, abnormal rw0Tg + MO3-dpysl2b control Fig. 3 from Fiallos-Oliveros et al., 2020
branchiomotor neuron neuron migration disrupted, abnormal rw0Tg + MO3-dpysl2b control Fig. 3 from Fiallos-Oliveros et al., 2020
rhombomere 6 branchiomotor neuron displaced to rhombomere 4, abnormal rw0Tg + MO3-dpysl2b control Fig. 3 from Fiallos-Oliveros et al., 2020
CaP motoneuron mislocalised, abnormal RW + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 2 from Morimura et al., 2013
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 1 with image,  Fig. 9 with image from Tanaka et al., 2012
retinal neural layer axon decreased branchiness, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 5 with image from Liu et al., 2018
retinal neural layer axon truncated, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 5 with image from Liu et al., 2018
neural crest cell displaced to spinal cord lateral margin, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 10 with image from Tanaka et al., 2012
Rohon-Beard neuron displaced to spinal cord axis, abnormal rw011bTg + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 7 with image from Tanaka et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.