Morpholino

MO2-meis2b

ID
ZDB-MRPHLNO-121026-1
Name
MO2-meis2b
Previous Names
  • E3I3 meis2b-MO (1)
Target
Sequence
5' - ACCGAAATCAATAACTTGCCTGTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-meis2b
Expressed Gene Anatomy Figures
myh7 Fig. 5 with image from Paige et al., 2012
myl7 Fig. 5 with image from Paige et al., 2012
Phenotype
Phenotype resulting from MO2-meis2b
Phenotype Fish Figures
cardioblast cell midline fusion disrupted, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
determination of heart left/right asymmetry disrupted, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
head decreased size, abnormal zf13Tg + MO2-meis2b Fig. S5 with image from Paige et al., 2012
head increased variability of size, abnormal zf13Tg + MO2-meis2b Fig. S5 with image from Paige et al., 2012
heart decreased functionality, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
heart position, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
heart contraction decreased frequency, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
heart development disrupted, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
heart looping disrupted, abnormal zf13Tg + MO2-meis2b Fig. 5 with image from Paige et al., 2012
pericardium edematous, abnormal zf13Tg + MO2-meis2b Fig. S5 with image from Paige et al., 2012
whole organism curvature, abnormal zf13Tg + MO2-meis2b Fig. S5 with image from Paige et al., 2012
Phenotype of all Fish created by or utilizing MO2-meis2b
Phenotype Fish Conditions Figures
pericardium edematous, abnormal zf13Tg + MO2-meis2b standard conditions Fig. S5 with image from Paige et al., 2012
heart development disrupted, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
determination of heart left/right asymmetry disrupted, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
cardioblast cell midline fusion disrupted, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
heart position, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
head decreased size, abnormal zf13Tg + MO2-meis2b standard conditions Fig. S5 with image from Paige et al., 2012
heart looping disrupted, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
whole organism curvature, abnormal zf13Tg + MO2-meis2b standard conditions Fig. S5 with image from Paige et al., 2012
heart decreased functionality, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
head increased variability of size, abnormal zf13Tg + MO2-meis2b standard conditions Fig. S5 with image from Paige et al., 2012
heart contraction decreased frequency, abnormal zf13Tg + MO2-meis2b standard conditions Fig. 5 with image from Paige et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.