Morpholino

MO1-lepr

ID

ZDB-MRPHLNO-121019-6

Name

MO1-lepr

Previous Names

lepRMO (1)

Target

lepr (1)

Sequence

5' - TCAAGACAGACATCATTTCACTTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lepr

No data available

Phenotype

Phenotype resulting from MO1-lepr

Phenotype	Fish	Figures
ball increased circumference, abnormal	WT + MO1-lepr	Fig. 3 from Liu et al., 2012
brain dorsal region physical object quality, abnormal	WT + MO1-lepr	Fig. 6 from Liu et al., 2012
brain development disrupted, abnormal	WT + MO1-lepr	Fig. 6 from Liu et al., 2012
cranial nerve II decreased thickness, abnormal	WT + MO1-lepr	Fig. 6 from Liu et al., 2012
eye decreased size, abnormal	WT + MO1-lepr	Fig. 3, Fig. 5 from Liu et al., 2012
eye development disrupted, abnormal	WT + MO1-lepr	Fig. 5 from Liu et al., 2012
otolith decreased size, abnormal	WT + MO1-lepr	Fig. 5 from Liu et al., 2012
oxygen metabolic process decreased rate, abnormal	WT + MO1-lepr	Fig. 1 from Dalman et al., 2013
pericardium edematous, abnormal	WT + MO1-lepr	Fig. 3 from Liu et al., 2012
post-vent region kinked, abnormal	WT + MO1-lepr	Fig. 3 from Liu et al., 2012
retina development in camera-type eye disrupted, abnormal	WT + MO1-lepr	Fig. 6 from Liu et al., 2012
retinal ganglion cell layer decreased size, abnormal	WT + MO1-lepr	Fig. 6 from Liu et al., 2012
secondary motor neuron axon branchiness, abnormal	WT + MO1-lepr	Fig. 6 from Liu et al., 2012
semicircular canal hypoplastic, abnormal	WT + MO1-lepr	Fig. 5, text only from Liu et al., 2012
semicircular canal development disrupted, abnormal	WT + MO1-lepr	Fig. 5, text only from Liu et al., 2012
trunk kinked, abnormal	WT + MO1-lepr	Fig. 3 from Liu et al., 2012
whole organism decreased size, abnormal	WT + MO1-lepr	Fig. 3 from Liu et al., 2012

Phenotype of all Fish created by or utilizing MO1-lepr

Phenotype	Fish	Conditions	Figures
semicircular canal hypoplastic, abnormal	WT + MO1-lepr	standard conditions	Fig. 5, text only from Liu et al., 2012
post-vent region kinked, abnormal	WT + MO1-lepr	standard conditions	Fig. 3 from Liu et al., 2012
retinal ganglion cell layer decreased size, abnormal	WT + MO1-lepr	standard conditions	Fig. 6 from Liu et al., 2012
pericardium edematous, abnormal	WT + MO1-lepr	standard conditions	Fig. 3 from Liu et al., 2012
eye development disrupted, abnormal	WT + MO1-lepr	standard conditions	Fig. 5 from Liu et al., 2012
trunk kinked, abnormal	WT + MO1-lepr	standard conditions	Fig. 3 from Liu et al., 2012
brain dorsal region physical object quality, abnormal	WT + MO1-lepr	standard conditions	Fig. 6 from Liu et al., 2012
ball increased circumference, abnormal	WT + MO1-lepr	standard conditions	Fig. 3 from Liu et al., 2012
retina development in camera-type eye disrupted, abnormal	WT + MO1-lepr	standard conditions	Fig. 6 from Liu et al., 2012
oxygen metabolic process decreased rate, abnormal	WT + MO1-lepr	standard conditions	Fig. 1 from Dalman et al., 2013
otolith decreased size, abnormal	WT + MO1-lepr	standard conditions	Fig. 5 from Liu et al., 2012
secondary motor neuron axon branchiness, abnormal	WT + MO1-lepr	standard conditions	Fig. 6 from Liu et al., 2012
semicircular canal development disrupted, abnormal	WT + MO1-lepr	standard conditions	Fig. 5, text only from Liu et al., 2012
cranial nerve II decreased thickness, abnormal	WT + MO1-lepr	standard conditions	Fig. 6 from Liu et al., 2012
whole organism decreased size, abnormal	WT + MO1-lepr	standard conditions	Fig. 3 from Liu et al., 2012
eye decreased size, abnormal	WT + MO1-lepr	standard conditions	Fig. 3, Fig. 5 from Liu et al., 2012
brain development disrupted, abnormal	WT + MO1-lepr	standard conditions	Fig. 6 from Liu et al., 2012

Citations