Morpholino

MO6-pitx2

ID

ZDB-MRPHLNO-120911-5

Name

MO6-pitx2

Previous Names

pitx2a MO (1)

Target

pitx2 (1)

Sequence

5' - TTTGCGGCAGTGGGAGTCCATTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-pitx2

No data available

Phenotype

Phenotype resulting from MO6-pitx2

Phenotype	Fish	Figures
cornea increased thickness, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
corneal endothelium absent, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
corneal epithelium disorganized, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
corneal epithelium scalloped, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
eye anterior-posterior axis decreased length, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
eye dorsal-ventral axis decreased length, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
mandibular muscle morphology, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
medial rectus increased thickness, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
medial rectus myofibril disorganized, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
photoreceptor outer segment layer absent, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012
retinal inner nuclear layer disorganized, abnormal	WT + MO6-pitx2	Fig. 1 from Bohnsack et al., 2012

Phenotype of all Fish created by or utilizing MO6-pitx2

Phenotype	Fish	Conditions	Figures
corneal epithelium disorganized, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
corneal endothelium absent, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
cornea increased thickness, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
medial rectus myofibril disorganized, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
eye dorsal-ventral axis decreased length, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
photoreceptor outer segment layer absent, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
mandibular muscle morphology, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
medial rectus increased thickness, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
retinal inner nuclear layer disorganized, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
eye anterior-posterior axis decreased length, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
corneal epithelium scalloped, abnormal	WT + MO6-pitx2	standard conditions	Fig. 1 from Bohnsack et al., 2012
pharyngeal arch cartilage absent, abnormal	mpv17^a9/a9; ba2Tg + MO6-pitx2	standard conditions	Fig. 2 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal	mpv17^a9/a9; ba2Tg + MO6-pitx2	standard conditions	Fig. 2 from Bohnsack et al., 2012
branchial muscle absent, abnormal	mpv17^a9/a9; zf13Tg + MO6-pitx2	standard conditions	Fig. 3 from Bohnsack et al., 2012
mandibular muscle morphology, abnormal	mpv17^a9/a9; zf13Tg + MO6-pitx2	standard conditions	Fig. 3 from Bohnsack et al., 2012

Citations