Morpholino

MO1-porcn

ID

ZDB-MRPHLNO-120614-3

Name

MO1-porcn

Previous Names

None

Target

porcn (1)

Sequence

5' - GCCTGTCTGCTCAGAGATCCCATTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-porcn

No data available

Phenotype

Phenotype resulting from MO1-porcn

Phenotype	Fish	Figures
convergent extension involved in axis elongation disrupted, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
mediolateral intercalation disrupted, abnormal	TL + MO1-porcn	Fig. 3 from Chen et al., 2012
neural tube shortened, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
notochord decreased length, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
notochord increased width, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
protein lipidation disrupted, abnormal	TL + MO1-porcn	Fig. 7 from Chen et al., 2012
somite condensed, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
trunk shortened, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
whole organism anterior-posterior axis decreased length, abnormal	TL + MO1-porcn	Fig. 2 from Chen et al., 2012
Wnt protein secretion disrupted, abnormal	TL + MO1-porcn	Fig. 6 from Chen et al., 2012

Phenotype of all Fish created by or utilizing MO1-porcn

Phenotype	Fish	Conditions	Figures
epiboly involved in gastrulation with mouth forming second arrested, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
notochord increased width, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
somite condensed, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
neural tube shortened, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
protein lipidation disrupted, abnormal	TL + MO1-porcn	standard conditions	Fig. 7 from Chen et al., 2012
mediolateral intercalation disrupted, abnormal	TL + MO1-porcn	standard conditions	Fig. 3 from Chen et al., 2012
trunk shortened, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
whole organism anterior-posterior axis decreased length, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
Wnt protein secretion disrupted, abnormal	TL + MO1-porcn	standard conditions	Fig. 6 from Chen et al., 2012
notochord decreased length, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
convergent extension involved in axis elongation disrupted, abnormal	TL + MO1-porcn	standard conditions	Fig. 2 from Chen et al., 2012
whole organism anterior-posterior axis decreased length, abnormal	TL + MO1-porcn + MO2-porcn	standard conditions	Fig. S4 from Chen et al., 2012
convergent extension involved in axis elongation disrupted, abnormal	TL + MO1-porcn + MO2-porcn	standard conditions	Fig. S4 from Chen et al., 2012
convergent extension involved in axis elongation disrupted, abnormal	TL + MO1-porcn + MO1-wnt5b	standard conditions	Fig. 4 from Chen et al., 2012
convergent extension involved in axis elongation disrupted, abnormal	TL + MO1-porcn + MO1-wnt11f2	standard conditions	Fig. 4 from Chen et al., 2012

Citations