Morpholino

MO1-draxina

ID
ZDB-MRPHLNO-120410-2
Name
MO1-draxina
Previous Names
  • MO1-draxin
  • MO1-neucrin
  • neucrin MO1 (1)
Target
Sequence
5' - GAGATCCCCTAGGAGAAAAAGATAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-draxina
Expressed Gene Anatomy Figures
axin2 Fig. 4 with image from Miyake et al., 2012
ccnd1 Fig. 4 with image from Miyake et al., 2012
isl1a Fig. 6 with image from Miyake et al., 2012
lmx1ba Fig. 5 with image from Miyake et al., 2012
msx1b Fig. 5 with image from Miyake et al., 2012
neurod4 Fig. 6 with image from Miyake et al., 2012
neurog1 Fig. 6 with image from Miyake et al., 2012
nkx6.2 Fig. 5 with image from Miyake et al., 2012
pax7a Fig. 5 with image from Miyake et al., 2012
wnt1 Fig. 5 with image from Miyake et al., 2012
Phenotype
Phenotype resulting from MO1-draxina
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-draxina Fig. 7 with image from Miyake et al., 2012
central nervous system development process quality, abnormal WT + MO1-draxina Fig. 3 with image,  Fig. S3 with image from Miyake et al., 2012
embryonic camera-type eye formation disrupted, abnormal WT + MO1-draxina Fig. 3 with image,  Fig. S3 with image from Miyake et al., 2012
eye decreased size, abnormal WT + MO1-draxina Fig. 3 with image from Miyake et al., 2012
retina layer formation disrupted, abnormal WT + MO1-draxina Fig. 3 with image from Miyake et al., 2012
somitogenesis process quality, abnormal WT + MO1-draxina Fig. S2 with image from Miyake et al., 2012
whole organism dead, abnormal WT + MO1-draxina Fig. S2 with image from Miyake et al., 2012
Phenotype of all Fish created by or utilizing MO1-draxina
Phenotype Fish Conditions Figures
eye decreased size, abnormal WT + MO1-draxina standard conditions Fig. 3 with image from Miyake et al., 2012
somitogenesis process quality, abnormal WT + MO1-draxina standard conditions Fig. S2 with image from Miyake et al., 2012
central nervous system development process quality, abnormal WT + MO1-draxina standard conditions Fig. 3 with image,  Fig. S3 with image from Miyake et al., 2012
retina layer formation disrupted, abnormal WT + MO1-draxina standard conditions Fig. 3 with image from Miyake et al., 2012
whole organism dead, abnormal WT + MO1-draxina standard conditions Fig. S2 with image from Miyake et al., 2012
apoptotic process increased occurrence, abnormal WT + MO1-draxina standard conditions Fig. 7 with image from Miyake et al., 2012
embryonic camera-type eye formation disrupted, abnormal WT + MO1-draxina standard conditions Fig. 3 with image,  Fig. S3 with image from Miyake et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.