Morpholino

MO1-tmprss4a

ID

ZDB-MRPHLNO-120328-1

Name

MO1-tmprss4a

Previous Names

None

Target

tmprss4a (1)

Sequence

5' - CATGAGTTTTGTGCGTTTTGCAGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tmprss4a

No data available

Phenotype

Phenotype resulting from MO1-tmprss4a

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	WT + MO1-tmprss4a	text only from Ohler et al., 2011
cell adhesion disrupted, abnormal	WT + MO1-tmprss4a	Fig. 6 from Ohler et al., 2011
embryo development disrupted, abnormal	WT + MO1-tmprss4a	Fig. 4 from Ohler et al., 2011
embryonic organ development disrupted, abnormal	WT + MO1-tmprss4a	Fig. 4 from Ohler et al., 2011
epidermis disorganized, abnormal	WT + MO1-tmprss4a	Fig. 6 from Ohler et al., 2011
heart contraction decreased rate, abnormal	WT + MO1-tmprss4a	text only from Ohler et al., 2011
keratinocyte detached from whole organism, abnormal	WT + MO1-tmprss4a	Fig. 6 from Ohler et al., 2011
muscle cell myofibril disorganized, abnormal	WT + MO1-tmprss4a	Fig. 5 from Ohler et al., 2011
musculature system disorganized, abnormal	WT + MO1-tmprss4a	Fig. 5 from Ohler et al., 2011
pericardium edematous, abnormal	WT + MO1-tmprss4a	Fig. 4 from Ohler et al., 2011
post-vent region disorganized, abnormal	WT + MO1-tmprss4a	Fig. 6 from Ohler et al., 2011
tissue development disrupted, abnormal	WT + MO1-tmprss4a	Fig. 4, Fig. 5 from Ohler et al., 2011
trunk disorganized, abnormal	WT + MO1-tmprss4a	Fig. 6 from Ohler et al., 2011
vasculature degenerate, abnormal	WT + MO1-tmprss4a	text only from Ohler et al., 2011
whole organism decreased size, abnormal	WT + MO1-tmprss4a	Fig. 4, Fig. 6 from Ohler et al., 2011
whole organism morphology, abnormal	WT + MO1-tmprss4a	Fig. 5 from Ohler et al., 2011
whole organism structure, abnormal	WT + MO1-tmprss4a	Fig. 4 from Ohler et al., 2011
whole organism viability, abnormal	WT + MO1-tmprss4a	Fig. 4 from Ohler et al., 2011

Phenotype of all Fish created by or utilizing MO1-tmprss4a

Phenotype	Fish	Conditions	Figures
epidermis disorganized, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 6 from Ohler et al., 2011
blood circulation disrupted, abnormal	WT + MO1-tmprss4a	standard conditions	text only from Ohler et al., 2011
whole organism morphology, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 5 from Ohler et al., 2011
keratinocyte detached from whole organism, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 6 from Ohler et al., 2011
trunk disorganized, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 6 from Ohler et al., 2011
vasculature degenerate, abnormal	WT + MO1-tmprss4a	standard conditions	text only from Ohler et al., 2011
heart contraction decreased rate, abnormal	WT + MO1-tmprss4a	standard conditions	text only from Ohler et al., 2011
tissue development disrupted, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4, Fig. 5 from Ohler et al., 2011
muscle cell myofibril disorganized, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 5 from Ohler et al., 2011
whole organism decreased size, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4, Fig. 6 from Ohler et al., 2011
post-vent region disorganized, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 6 from Ohler et al., 2011
whole organism structure, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4 from Ohler et al., 2011
whole organism viability, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4 from Ohler et al., 2011
embryonic organ development disrupted, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4 from Ohler et al., 2011
embryo development disrupted, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4 from Ohler et al., 2011
pericardium edematous, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 4 from Ohler et al., 2011
cell adhesion disrupted, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 6 from Ohler et al., 2011
musculature system disorganized, abnormal	WT + MO1-tmprss4a	standard conditions	Fig. 5 from Ohler et al., 2011

Citations