Morpholino

MO1-flncb

ID
ZDB-MRPHLNO-120320-1
Name
MO1-flncb
Previous Names
None
Target
Sequence
5' - CCGATTCACCTGAGAGAGGAGAGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-flncb
No data available
Phenotype
Phenotype resulting from MO1-flncb
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-flncb Fig. 5,  Fig. S6 from Adams et al., 2012
cilium assembly decreased process quality, abnormal WT + MO1-flncb Fig. 5,  Fig. S6 from Adams et al., 2012
eye decreased size, abnormal WT + MO1-flncb Fig. S6 from Adams et al., 2012
eye malformed, abnormal WT + MO1-flncb Fig. 5,  Fig. S6 from Adams et al., 2012
heart edematous, abnormal WT + MO1-flncb Fig. 5,  Fig. S6 from Adams et al., 2012
inner ear malformed, abnormal WT + MO1-flncb Fig. 5,  Fig. S6 from Adams et al., 2012
post-vent region malformed, abnormal WT + MO1-flncb Fig. 5,  Fig. S6 from Adams et al., 2012
pronephros cystic, abnormal WT + MO1-flncb Fig. 5 from Adams et al., 2012
Phenotype of all Fish created by or utilizing MO1-flncb
Phenotype Fish Conditions Figures
heart edematous, abnormal WT + MO1-flncb standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
pronephros cystic, abnormal WT + MO1-flncb standard conditions Fig. 5 from Adams et al., 2012
post-vent region malformed, abnormal WT + MO1-flncb standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
eye decreased size, abnormal WT + MO1-flncb standard conditions Fig. S6 from Adams et al., 2012
eye malformed, abnormal WT + MO1-flncb standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
inner ear malformed, abnormal WT + MO1-flncb standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
cilium assembly decreased process quality, abnormal WT + MO1-flncb standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
brain hydrocephalic, abnormal WT + MO1-flncb standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
cilium assembly decreased process quality, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
brain hydrocephalic, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
notochord malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
heart edematous, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
pronephros cystic, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
eye malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5 from Adams et al., 2012
post-vent region malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
inner ear malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5 from Adams et al., 2012
brain malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5 from Adams et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.