Morpholino

MO2-wif1

ID
ZDB-MRPHLNO-120319-4
Name
MO2-wif1
Previous Names
  • i1e2-MO (1)
Target
Sequence
5' - AAACCTGTTCAATAAAACACTGCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wif1
Expressed Gene Anatomy Figures
acta2 Fig. 4 from Yin et al., 2012
anxa5b Fig. 4 from Yin et al., 2012
axin2 Fig. 2 from Yin et al., 2012
has2 Fig. 4 from Yin et al., 2012
lef1 Fig. 2 from Yin et al., 2012
mnx1 Fig. 4 from Yin et al., 2012
Phenotype
Phenotype resulting from MO2-wif1
Phenotype Fish Figures
anterior swim bladder bud absent, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO2-wif1 Fig. 3 from Yin et al., 2012
canonical Wnt signaling pathway increased occurrence, abnormal WT + MO2-wif1 Fig. 2 from Yin et al., 2012
pancreas morphology, abnormal WT + MO2-wif1 Fig. 4 from Yin et al., 2012
smooth muscle tissue development disrupted, abnormal WT + MO2-wif1 Fig. 4 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO2-wif1 Fig. 3 from Yin et al., 2012
swim bladder decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 Fig. 3,  Fig. 5 from Yin et al., 2012
swim bladder epithelium decreased size, abnormal WT + MO2-wif1 Fig. 4 from Yin et al., 2012
swim bladder mesenchyme decreased size, abnormal WT + MO2-wif1 Fig. 4 from Yin et al., 2012
swim bladder development disrupted, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 Fig. 3,  Fig. 4,  Fig. 5 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO2-wif1 Fig. 3 from Yin et al., 2012
tunica interna swim bladder smooth muscle absent, abnormal WT + MO2-wif1 Fig. 4 from Yin et al., 2012
visceral peritoneum disorganized, abnormal WT + MO2-wif1 Fig. 4 from Yin et al., 2012
Phenotype of all Fish created by or utilizing MO2-wif1
Phenotype Fish Conditions Figures
swim bladder decreased size, abnormal WT + MO2-wif1 standard conditions Fig. 5 from Yin et al., 2012
smooth muscle tissue development disrupted, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
swim bladder development disrupted, abnormal WT + MO2-wif1 standard conditions Fig. 4,  Fig. 5 from Yin et al., 2012
canonical Wnt signaling pathway increased occurrence, abnormal WT + MO2-wif1 standard conditions Fig. 2 from Yin et al., 2012
swim bladder mesenchyme decreased size, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
swim bladder epithelium decreased size, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
visceral peritoneum disorganized, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
pancreas morphology, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
tunica interna swim bladder smooth muscle absent, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
interpeduncular nucleus tegmentum innervation process quality, abnormal hd1Tg + MO1-wif1 + MO2-wif1 standard conditions Fig. 4 with image from Guglielmi et al., 2020
habenula neuron decreased amount, abnormal hd1Tg + MO1-wif1 + MO2-wif1 standard conditions Fig. 4 with image from Guglielmi et al., 2020
swim bladder development disrupted, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud absent, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
swim bladder decreased size, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud absent, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder development disrupted, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.