Morpholino

MO4-irx1a

ID

ZDB-MRPHLNO-120315-1

Name

MO4-irx1a

Previous Names

Target

Sequence

5' - AGAAATGGACTTACTACCATTTGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Sequence provided by Dr. Choy. Not an exact match to genomic sequences currently in sequence databanks.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-irx1a

Expressed Gene	Anatomy	Figures
irx1a	whole organism	Fig. 2 from Choy et al., 2010
irx2a	(not) retina whole organism	Fig. 2 , Fig. 5 from Choy et al., 2010
irx4a	retina retinal ganglion cell layer	Fig. 5 from Choy et al., 2010

Phenotype

Phenotype resulting from MO4-irx1a

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO4-irx1a	Fig. 6 from Choy et al., 2010
neural retina development disrupted, abnormal	WT + MO4-irx1a	Fig. 6 , Fig. 7 from Choy et al., 2010
retina layer formation disrupted, abnormal	sb28Tg + MO4-irx1a	Fig. 7 from Choy et al., 2010
retinal cone cell decreased amount, abnormal	WT + MO4-irx1a	Fig. 4 from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal	sb28Tg + MO4-irx1a	Fig. 6 , Fig. 7 from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal	sb28Tg + MO4-irx1a	Fig. 6 , Fig. 7 from Choy et al., 2010
retinal rod cell decreased amount, abnormal	WT + MO4-irx1a	Fig. 4 from Choy et al., 2010

Phenotype of all Fish created by or utilizing MO4-irx1a

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	WT + MO4-irx1a	standard conditions	Fig. 6 from Choy et al., 2010
retinal cone cell decreased amount, abnormal	WT + MO4-irx1a	standard conditions	Fig. 4 from Choy et al., 2010
neural retina development disrupted, abnormal	WT + MO4-irx1a	standard conditions	Fig. 6 from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal	WT + MO4-irx1a	standard conditions	Fig. 6 from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal	WT + MO4-irx1a	standard conditions	Fig. 6 from Choy et al., 2010
retinal rod cell decreased amount, abnormal	WT + MO4-irx1a	standard conditions	Fig. 4 from Choy et al., 2010
neural retina development disrupted, abnormal	sb28Tg + MO4-irx1a	standard conditions	Fig. 7 from Choy et al., 2010
retina layer formation disrupted, abnormal	sb28Tg + MO4-irx1a	standard conditions	Fig. 7 from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal	sb28Tg + MO4-irx1a	standard conditions	Fig. 7 from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal	sb28Tg + MO4-irx1a	standard conditions	Fig. 7 from Choy et al., 2010
eye decreased size, abnormal	WT + MO2-irx2a + MO4-irx1a	standard conditions	Fig. 6 from Choy et al., 2010

Citations