Morpholino

MO1-ahi1

ID
ZDB-MRPHLNO-120314-2
Name
MO1-ahi1
Previous Names
  • SPL8MO (1)
Target
Sequence
5' - CCACACTCTGAAAGGGAAAAACATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahi1
Expressed Gene Anatomy Figures
ahi1 Fig. 3 from Simms et al., 2012
Phenotype
Phenotype resulting from MO1-ahi1
Phenotype Fish Figures
brain hydrocephalic, abnormal AB/TU + MO1-ahi1 Fig. 3 from Elsayed et al., 2015
Fig. 3 from Simms et al., 2012
camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
eye decreased size, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
eye malformed, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
heart bilateral symmetry, abnormal twu34Tg + MO1-ahi1 Fig. 5 from Simms et al., 2012
heart edematous, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
heart looping decreased process quality, abnormal twu34Tg + MO1-ahi1 Fig. 5 from Simms et al., 2012
inner ear has fewer parts of type otolith, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
inner ear morphogenesis decreased process quality, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
kidney morphogenesis decreased process quality, abnormal zf106Tg + MO1-ahi1 Fig. 6 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 Fig. 4 from Simms et al., 2012
otic vesicle morphology, abnormal AB/TU + MO1-ahi1 Fig. 3 from Elsayed et al., 2015
post-vent region curled, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
pronephric duct lacks parts or has fewer parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 Fig. 6 from Simms et al., 2012
pronephros cystic, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
pronephros dilated, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
retinal ganglion cell axon decreased length, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon extension process quality, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon guidance disrupted, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
whole organism anatomical axis curved, abnormal AB/TU + MO1-ahi1 Fig. 3 from Elsayed et al., 2015
Phenotype of all Fish created by or utilizing MO1-ahi1
Phenotype Fish Conditions Figures
retinal ganglion cell axon guidance disrupted, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon extension process quality, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
eye decreased size, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon decreased length, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
whole organism anatomical axis curved, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
brain hydrocephalic, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
otic vesicle morphology, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
eye malformed, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
heart edematous, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
pronephros cystic, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
pronephros dilated, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
inner ear has fewer parts of type otolith, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
post-vent region curled, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
brain hydrocephalic, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
inner ear morphogenesis decreased process quality, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
heart bilateral symmetry, abnormal twu34Tg + MO1-ahi1 standard conditions Fig. 5 from Simms et al., 2012
heart looping decreased process quality, abnormal twu34Tg + MO1-ahi1 standard conditions Fig. 5 from Simms et al., 2012
pronephric duct lacks parts or has fewer parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 6 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
kidney morphogenesis decreased process quality, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 6 from Simms et al., 2012
motile cilium assembly decreased process quality, abnormal slc24a5b1/b1 + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal slc24a5b1/b1 + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
Citations