Morpholino

MO4-rp2

ID

ZDB-MRPHLNO-120222-8

Name

MO4-rp2

Previous Names

Target

Sequence

5' - TGGAGAAGAAGCACCCCATTTATGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-rp2

No data available

Phenotype

Phenotype resulting from MO4-rp2

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	AB + MO4-rp2	Fig. 5 from Shu et al., 2011
extension decreased width, abnormal	AB + MO4-rp2	Fig. 3 from Shu et al., 2011
eye decreased size, abnormal	AB + MO4-rp2	Fig. 3 from Shu et al., 2011
eye opaque, abnormal	AB + MO4-rp2	Fig. 3 from Shu et al., 2011
midbrain hindbrain boundary blurry, abnormal	AB + MO4-rp2	Fig. 3 from Shu et al., 2011
post-vent region curved, abnormal	AB + MO4-rp2	Fig. 3 from Shu et al., 2011
retina layer formation disrupted, abnormal	AB + MO4-rp2	Fig. 4 from Shu et al., 2011
retinal cone cell photoreceptor outer segment absent, abnormal	AB + MO4-rp2	Fig. 4 from Shu et al., 2011
retinal ganglion cell layer absent, abnormal	AB + MO4-rp2	Fig. 4 from Shu et al., 2011
retinal inner nuclear layer absent, abnormal	AB + MO4-rp2	Fig. 4 from Shu et al., 2011
retinal outer nuclear layer absent, abnormal	AB + MO4-rp2	Fig. 4 from Shu et al., 2011
retinal rod cell photoreceptor outer segment absent, abnormal	AB + MO4-rp2	Fig. 4 from Shu et al., 2011

Phenotype of all Fish created by or utilizing MO4-rp2

Phenotype	Fish	Conditions	Figures
retinal outer nuclear layer absent, abnormal	AB + MO4-rp2	standard conditions	Fig. 4 from Shu et al., 2011
eye decreased size, abnormal	AB + MO4-rp2	standard conditions	Fig. 3 from Shu et al., 2011
extension decreased width, abnormal	AB + MO4-rp2	standard conditions	Fig. 3 from Shu et al., 2011
retinal ganglion cell layer absent, abnormal	AB + MO4-rp2	standard conditions	Fig. 4 from Shu et al., 2011
post-vent region curved, abnormal	AB + MO4-rp2	standard conditions	Fig. 3 from Shu et al., 2011
retinal inner nuclear layer absent, abnormal	AB + MO4-rp2	standard conditions	Fig. 4 from Shu et al., 2011
apoptotic process increased occurrence, abnormal	AB + MO4-rp2	standard conditions	Fig. 5 from Shu et al., 2011
retina layer formation disrupted, abnormal	AB + MO4-rp2	standard conditions	Fig. 4 from Shu et al., 2011
midbrain hindbrain boundary blurry, abnormal	AB + MO4-rp2	standard conditions	Fig. 3 from Shu et al., 2011
eye opaque, abnormal	AB + MO4-rp2	standard conditions	Fig. 3 from Shu et al., 2011
retinal cone cell photoreceptor outer segment absent, abnormal	AB + MO4-rp2	standard conditions	Fig. 4 from Shu et al., 2011
retinal rod cell photoreceptor outer segment absent, abnormal	AB + MO4-rp2	standard conditions	Fig. 4 from Shu et al., 2011

Citations