Morpholino

MO2-irf8

ID

ZDB-MRPHLNO-111212-3

Name

MO2-irf8

Previous Names

irf8 MOatg (1)

Target

irf8 (1)

Sequence

5' - TCAGTCTGCGACCGCCCGAGTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-irf8

Expressed Gene	Anatomy	Figures
lyz	neutrophil	Fig. S8 from He et al., 2015
mfap4.1	macrophage	Fig. S8 from He et al., 2015
runx1	ventral wall of dorsal aorta hematopoietic multipotent progenitor cell	Fig. S8 from He et al., 2015

Phenotype

Phenotype resulting from MO2-irf8

Phenotype	Fish	Figures
macrophage decreased amount, abnormal	TU + MO2-irf8	Fig. 5 from Ellett et al., 2018 Fig. S8 from He et al., 2015 Fig. 7 from Prajsnar et al., 2012
neutrophil increased amount, abnormal	TU + MO2-irf8	Fig. 5 from Ellett et al., 2018 Fig. S8 from He et al., 2015 Fig. 7 from Prajsnar et al., 2012

Phenotype of all Fish created by or utilizing MO2-irf8

Phenotype	Fish	Conditions	Figures
macrophage decreased amount, abnormal	TU + MO2-irf8	standard conditions	Fig. S8 from He et al., 2015
neutrophil increased amount, abnormal	TU + MO2-irf8	standard conditions	Fig. S8 from He et al., 2015
macrophage decreased amount, abnormal	WT + MO2-irf8	standard conditions	Fig. 7 from Prajsnar et al., 2012
neutrophil increased amount, abnormal	WT + MO2-irf8	standard conditions	Fig. 7 from Prajsnar et al., 2012
brain vasculature wound healing decreased occurrence, abnormal	cq10Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature, chemical treatment by environment: nocodazole	Fig. 6 from Liu et al., 2016
brain vasculature wound healing decreased efficacy, abnormal	cq10Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature	Fig. 6 from Liu et al., 2016
brain vasculature wound healing process efficacy, ameliorated	cq10Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature, chemical treatment by environment: NSC 23766	Fig. 7 from Liu et al., 2016
brain vasculature wound healing increased duration, abnormal	cq10Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature	Fig. 6 from Liu et al., 2016
brain vasculature wound healing duration, ameliorated	cq10Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature, chemical treatment by environment: NSC 23766	Fig. 7 from Liu et al., 2016
regenerating tissue endothelial cell RaichuEV expression decreased amount, abnormal	cq17Tg; hkz04tTg + MO2-irf8	light ablation: brain vasculature	Fig. 7 from Liu et al., 2016
defense response to fungus increased efficacy, abnormal	gl23Tg; i113Tg + MO2-irf8	fungal treatment by injection: Talaromyces marneffei	Fig. 5 from Ellett et al., 2018
macrophage decreased amount, abnormal	gl23Tg; i113Tg + MO2-irf8	control	Fig. 5 from Ellett et al., 2018
neutrophil increased amount, abnormal	gl23Tg; i113Tg + MO2-irf8	control	Fig. 5 from Ellett et al., 2018
brain vasculature wound healing duration, ameliorated	cq21Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature	Fig. 7 from Liu et al., 2016
brain vasculature wound healing process efficacy, ameliorated	cq21Tg; hkz04tTg; nz50Tg + MO2-irf8	light ablation: brain vasculature	Fig. 7 from Liu et al., 2016
defense response to fungus increased efficacy, abnormal	mpx^gl8/gl8; gl23Tg; i113Tg + MO2-irf8	fungal treatment by injection: Talaromyces marneffei	Fig. 5 from Ellett et al., 2018

Citations