Morpholino

MO2-npnta

ID
ZDB-MRPHLNO-111018-2
Name
MO2-npnta
Previous Names
  • MO2-npnt
Target
Sequence
5' - TGTGAAACGGCAGACGGAACTCACT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-npnta
Expressed Gene Anatomy Figures
alcama Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image from Patra et al., 2011
bmp4 Fig. 4 with image,  Fig. 6 with image from Patra et al., 2011
fbln1 Fig. 4 with image from Patra et al., 2011
has2 Fig. 5 with image,  Fig. 7 with image from Patra et al., 2011
myh6 Fig. 4 with image from Patra et al., 2011
myh7 Fig. 4 with image from Patra et al., 2011
notch1b Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image from Patra et al., 2011
npnta Fig. 4 from Müller-Deile et al., 2021
tbx2b Fig. 5 with image from Patra et al., 2011
vcana Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image from Patra et al., 2011
Phenotype
Phenotype resulting from MO2-npnta
Phenotype Fish Figures
atrioventricular canal cardiac muscle cell increased amount, abnormal f2Tg; s883Tg + MO2-npnta Fig. 4 with image from Patra et al., 2011
atrioventricular canal endocardium increased length, abnormal s843Tg + MO2-npnta Fig. 6 with image from Patra et al., 2011
atrioventricular valve increased length, abnormal WT + MO2-npnta Fig. 4 with image from Patra et al., 2011
atrioventricular valve morphology, abnormal f2Tg + MO2-npnta Fig. 2 with image,  Fig. 3 with image from Patra et al., 2011
atrioventricular valve morphogenesis disrupted, abnormal WT + MO2-npnta Fig. 2 with image from Patra et al., 2011
cardiac jelly increased volume, abnormal WT + MO2-npnta Fig. 2 with image,  Fig. 5 with image from Patra et al., 2011
cardiac jelly mislocalised, abnormal WT + MO2-npnta Fig. 2 with image,  Fig. 5 with image from Patra et al., 2011
endocardium far from myocardium, abnormal WT + MO2-npnta Fig. 5 with image from Patra et al., 2011
eye vascular plexus EGFP expression absent, abnormal lri500Tg + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
glomerular basement membrane increased width, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
glomerular basement membrane morphology, abnormal WT + MO2-npnta Fig. 5 from Müller-Deile et al., 2021
glomerular basement membrane wrinkled, abnormal WT + MO2-npnta Fig. 5 from Müller-Deile et al., 2021
glomerular filtration disrupted, abnormal lri500Tg + MO2-npnta Fig. 2 from Müller-Deile et al., 2017
heart straight, abnormal s883Tg + MO2-npnta Fig. 3 with image from Patra et al., 2011
heart trabecula formation disrupted, abnormal s883Tg + MO2-npnta Fig. 2 with image from Patra et al., 2011
lamina densa increased width, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
lamina rara interna increased width, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
lamina rara interna structure, cavities, abnormal WT + MO2-npnta Fig. 3 from Müller-Deile et al., 2017
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO2-npnta Fig. 2 from Müller-Deile et al., 2017
pericardium edematous, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
Fig. 2 with image from Patra et al., 2011
podocyte decreased thickness, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
podocyte microvillus increased length, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
pronephric podocyte podocyte foot flattened, abnormal WT + MO2-npnta Fig. 3 from Müller-Deile et al., 2017
trabecular layer morphology, abnormal s883Tg + MO2-npnta Fig. 2 with image from Patra et al., 2011
whole organism dead, abnormal WT + MO2-npnta Fig. 2 with image from Patra et al., 2011
whole organism npnta expression decreased amount, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
yolk syncytial layer edematous, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
Phenotype of all Fish created by or utilizing MO2-npnta
Phenotype Fish Conditions Figures
cardiac jelly mislocalised, abnormal WT + MO2-npnta standard conditions Fig. 2 with image,  Fig. 5 with image from Patra et al., 2011
podocyte microvillus increased length, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
podocyte decreased thickness, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
cardiac jelly increased volume, abnormal WT + MO2-npnta standard conditions Fig. 2 with image,  Fig. 5 with image from Patra et al., 2011
endocardium far from myocardium, abnormal WT + MO2-npnta standard conditions Fig. 5 with image from Patra et al., 2011
pericardium edematous, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
Fig. 2 with image from Patra et al., 2011
atrioventricular valve morphogenesis disrupted, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
heart trabecula formation disrupted, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
whole organism dead, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
glomerular basement membrane increased permeability, abnormal WT + MO2-npnta chemical treatment by injection: gold nanoparticle Fig. 6 from Müller-Deile et al., 2021
pronephric podocyte podocyte foot flattened, abnormal WT + MO2-npnta standard conditions Fig. 3 from Müller-Deile et al., 2017
lamina rara interna increased width, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
glomerular basement membrane increased width, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
podocyte increased permeability, abnormal WT + MO2-npnta chemical treatment by injection: gold nanoparticle Fig. 6 from Müller-Deile et al., 2021
lamina densa increased width, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
trabecular layer morphology, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
glomerular basement membrane wrinkled, abnormal WT + MO2-npnta control Fig. 5 from Müller-Deile et al., 2021
pronephric glomerulus glomerular filtration decreased process quality, abnormal WT + MO2-npnta chemical treatment by injection: gold nanoparticle Fig. 6 from Müller-Deile et al., 2021
atrioventricular valve increased length, abnormal WT + MO2-npnta standard conditions Fig. 4 with image from Patra et al., 2011
glomerular basement membrane morphology, abnormal WT + MO2-npnta control Fig. 5 from Müller-Deile et al., 2021
yolk syncytial layer edematous, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
lamina rara interna structure, cavities, abnormal WT + MO2-npnta standard conditions Fig. 3 from Müller-Deile et al., 2017
atrioventricular valve morphology, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
urine protein increased amount, abnormal WT + MO2-npnta chemical treatment by injection: dextran Fig. 2 from Müller-Deile et al., 2017
whole organism npnta expression decreased amount, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
atrioventricular valve morphology, abnormal f2Tg + MO2-npnta standard conditions Fig. 3 with image from Patra et al., 2011
eye vascular plexus EGFP expression absent, abnormal lri500Tg + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO2-npnta standard conditions Fig. 2 from Müller-Deile et al., 2017
glomerular filtration disrupted, abnormal lri500Tg + MO2-npnta standard conditions Fig. 2 from Müller-Deile et al., 2017
atrioventricular canal endocardium increased length, abnormal s843Tg + MO2-npnta standard conditions Fig. 6 with image from Patra et al., 2011
atrioventricular valve morphology, abnormal s883Tg + MO2-npnta standard conditions Fig. 3 with image from Patra et al., 2011
heart straight, abnormal s883Tg + MO2-npnta standard conditions Fig. 3 with image from Patra et al., 2011
trabecular layer morphology, abnormal s883Tg + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
heart trabecula formation disrupted, abnormal s883Tg + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
atrioventricular valve increased length, abnormal f2Tg; s883Tg + MO2-npnta standard conditions Fig. 4 with image from Patra et al., 2011
atrioventricular canal cardiac muscle cell increased amount, abnormal f2Tg; s883Tg + MO2-npnta standard conditions Fig. 4 with image from Patra et al., 2011
cardiac jelly decreased volume, abnormal WT + MO1-has2 + MO2-npnta standard conditions Fig. 5 with image from Patra et al., 2011
atrioventricular canal endocardium decreased length, abnormal s843Tg + MO1-has2 + MO2-npnta standard conditions Fig. 6 with image from Patra et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.