Morpholino

MO1-mir126a

ID
ZDB-MRPHLNO-110926-1
Name
MO1-mir126a
Previous Names
None
Target
Sequence
5' - CAGATAAACCCACTGCCACAGTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir126a
Expressed Gene Anatomy Figures
cxcl12a Fig. 4 with image from Chen et al., 2016
tek Fig. 5 with image from Chen et al., 2016
Phenotype
Phenotype resulting from MO1-mir126a
Phenotype Fish Figures
cranium hemorrhagic, abnormal y1Tg + MO1-mir126a Fig. 5 from Zou et al., 2011
horizontal myoseptum cxcl12a expression decreased distribution, abnormal TU + MO1-mir126a Fig. 4 with image from Chen et al., 2016
horizontal myoseptum Ab1-cxcl12 labeling decreased distribution, abnormal TU + MO1-mir126a Fig. 4 with image from Chen et al., 2016
lymphangioblast cord absent, abnormal y1Tg + MO1-mir126a Fig. 3 with image from Chen et al., 2016
lymphangiogenesis disrupted, abnormal y1Tg + MO1-mir126a Fig. 1 with image,  Fig. 3 with image,  Fig. 5 with image from Chen et al., 2016
lymphangiogenic sprout absent, abnormal y1Tg + MO1-mir126a Fig. 3 with image from Chen et al., 2016
lymphatic endothelial cell migration disrupted, abnormal y1Tg + MO1-mir126a Fig. 3 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout absent, abnormal y1Tg + MO1-mir126a Fig. 5 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout decreased amount, abnormal y1Tg + MO1-mir126a Fig. 5 with image from Chen et al., 2016
posterior cardinal vein vascular sprouts tek expression decreased distribution, abnormal TU + MO1-mir126a Fig. 5 with image from Chen et al., 2016
thoracic duct absent, abnormal y1Tg + MO1-mir126a Fig. 1 with image from Chen et al., 2016
thoracic duct decreased length, abnormal y1Tg + MO1-mir126a Fig. 6 with image from Chen et al., 2016
thoracic duct hypoplastic, abnormal y1Tg + MO1-mir126a Fig. 1 with image,  Fig. 6 with image from Chen et al., 2016
vascular lymphangioblast absent, abnormal y1Tg + MO1-mir126a Fig. 1 with image,  Fig. 3 with image from Chen et al., 2016
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-mir126a Fig. 6 with image from Chen et al., 2016
Phenotype of all Fish created by or utilizing MO1-mir126a
Phenotype Fish Conditions Figures
horizontal myoseptum Ab1-cxcl12 labeling decreased distribution, abnormal TU + MO1-mir126a standard conditions Fig. 4 with image from Chen et al., 2016
horizontal myoseptum cxcl12a expression decreased distribution, abnormal TU + MO1-mir126a standard conditions Fig. 4 with image from Chen et al., 2016
posterior cardinal vein vascular sprouts tek expression decreased distribution, abnormal TU + MO1-mir126a standard conditions Fig. 5 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout decreased amount, abnormal y1Tg + MO1-mir126a standard conditions Fig. 5 with image from Chen et al., 2016
lymphangiogenic sprout absent, abnormal y1Tg + MO1-mir126a standard conditions Fig. 3 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout absent, abnormal y1Tg + MO1-mir126a standard conditions Fig. 5 with image from Chen et al., 2016
cranium hemorrhagic, abnormal y1Tg + MO1-mir126a standard conditions Fig. 5 from Zou et al., 2011
thoracic duct hypoplastic, abnormal y1Tg + MO1-mir126a standard conditions Fig. 1 with image,  Fig. 6 with image from Chen et al., 2016
lymphangiogenesis disrupted, abnormal y1Tg + MO1-mir126a standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 5 with image from Chen et al., 2016
thoracic duct absent, abnormal y1Tg + MO1-mir126a standard conditions Fig. 1 with image from Chen et al., 2016
lymphatic endothelial cell migration disrupted, abnormal y1Tg + MO1-mir126a standard conditions Fig. 3 with image from Chen et al., 2016
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-mir126a control Fig. 6 with image from Chen et al., 2016
vascular lymphangioblast absent, abnormal y1Tg + MO1-mir126a standard conditions Fig. 1 with image,  Fig. 3 with image from Chen et al., 2016
thoracic duct decreased length, abnormal y1Tg + MO1-mir126a control Fig. 6 with image from Chen et al., 2016
lymphangioblast cord absent, abnormal y1Tg + MO1-mir126a standard conditions Fig. 3 with image from Chen et al., 2016
cranial blood vessel decreased diameter, abnormal s843Tg + MO1-mir126a + MO1-mir126b standard conditions Fig. S II from Zou et al., 2011
cranium hemorrhagic, abnormal y1Tg + MO1-mir126a + MO1-mir126b standard conditions Fig. 5 from Zou et al., 2011
thoracic duct hypoplastic, abnormal y1Tg + MO1-mir126a + MO3-flt4 standard conditions Fig. 6 with image from Chen et al., 2016
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-mir126a + MO3-flt4 standard conditions Fig. 6 with image from Chen et al., 2016
thoracic duct decreased length, abnormal y1Tg + MO1-mir126a + MO3-flt4 standard conditions Fig. 6 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout decreased amount, abnormal y1Tg + MO1-mir126a + MO4-plcg1 control Fig. 6 with image from Chen et al., 2016
vascular sprouts decreased amount, abnormal y1Tg + MO1-mir126a + MO4-plcg1 standard conditions Fig. 5 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout decreased amount, abnormal y1Tg + MO1-mir126a + MO3-flt4 + MO4-plcg1 control Fig. 6 with image from Chen et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.