Morpholino
MO1-ncf1
- ID
- ZDB-MRPHLNO-110804-1
- Name
- MO1-ncf1
- Previous Names
-
- p47phox (1)
- Target
- Sequence
-
5' - CGGCGAGATGAAGTGTGTGAGCGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ncf1
No data available
Phenotype
Phenotype resulting from MO1-ncf1
Phenotype | Fish | Figures |
---|---|---|
respiratory burst decreased process quality, abnormal | WT + MO1-ncf1 |
Fig. 4
from Brothers et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-ncf1
1 - 4 of 4
Citations
- Sipka, T., Peroceschi, R., Hassan-Abdi, R., Groß, M., Ellett, F., Begon-Pescia, C., Gonzalez, C., Lutfalla, G., Nguyen-Chi, M. (2021) Damage-Induced Calcium Signaling and Reactive Oxygen Species Mediate Macrophage Activation in Zebrafish. Frontiers in immunology. 12:636585
- Phan, Q.T., Sipka, T., Gonzalez, C., Levraud, J.P., Lutfalla, G., Nguyen-Chi, M. (2018) Neutrophils use superoxide to control bacterial infection at a distance. PLoS pathogens. 14:e1007157
- Brothers, K.M., Gratacap, R.L., Barker, S.E., Newman, Z.R., Norum, A., and Wheeler, R.T. (2013) NADPH Oxidase-Driven Phagocyte Recruitment Controls Candida albicans Filamentous Growth and Prevents Mortality. PLoS pathogens. 9(10):e1003634
- Brothers, K., Newman, Z., and Wheeler, R. (2011) Live imaging of disseminated candidiasis in zebrafish reveals role of phagocyte oxidase in limiting filamentous growth. Eukaryotic Cell. 10(7):932-44
1 - 4 of 4
Show