Morpholino

MO2-ltbp3

ID
ZDB-MRPHLNO-110801-4
Name
MO2-ltbp3
Previous Names
  • MOspl (1)
Target
Sequence
5' - ACCACCTGGACAGATACATTTATTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to second-intron splice acceptor sequence
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ltbp3
Expressed Gene Anatomy Figures
elnb Fig. 2 from Zhou et al., 2011
mir145 Fig. 6 with image from Gays et al., 2017
Phenotype
Phenotype resulting from MO2-ltbp3
Phenotype Fish Figures
bulbus arteriosus lacks all parts of type smooth muscle myoblast, abnormal WT + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
cardiac ventricle has fewer parts of type ventricular endocardium, abnormal y7Tg + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
cardiac ventricle physical object quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 Fig. 3 from Zhou et al., 2011
cardiac ventricle morphogenesis decreased process quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 Fig. 3 from Zhou et al., 2011
heart looping decreased process quality, abnormal WT + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
intestine smooth muscle ab1-tagln labeling decreased amount, abnormal uto5Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
intestine smooth muscle mCherry expression decreased amount, abnormal uto5Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal s854Tg; uto5Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
lateral plate mesoderm tissue migration decreased occurrence, abnormal pd24Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
lateral plate mesoderm tissue migration decreased process quality, abnormal pd24Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
outflow tract morphogenesis decreased process quality, abnormal fb2Tg; fb7Tg + MO2-ltbp3 Fig. 3,  Fig. 4 from Zhou et al., 2011
pharyngeal vasculature hypoplastic, abnormal s843Tg + MO2-ltbp3 Fig. S6 from Zhou et al., 2011
pharyngeal vasculature malformed, abnormal s843Tg + MO2-ltbp3 Fig. S6 from Zhou et al., 2011
presumptive bulbus arteriosus hypoplastic, abnormal WT + MO2-ltbp3 Fig. 3,  Fig. 4 from Zhou et al., 2011
presumptive cardiac ventricle heart tube decreased length, abnormal WT + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal WT + MO2-ltbp3 Fig. 4 from Zhou et al., 2011
whole organism mir145 expression decreased amount, abnormal WT + MO2-ltbp3 Fig. 6 with image from Gays et al., 2017
whole organism lacks all parts of type ventral aorta, abnormal WT + MO2-ltbp3 text only from Zhou et al., 2011
Phenotype of all Fish created by or utilizing MO2-ltbp3
Phenotype Fish Conditions Figures
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal WT + MO2-ltbp3 standard conditions Fig. 4 from Zhou et al., 2011
presumptive bulbus arteriosus hypoplastic, abnormal WT + MO2-ltbp3 standard conditions Fig. 4 from Zhou et al., 2011
outflow tract morphogenesis decreased process quality, abnormal WT + MO2-ltbp3 standard conditions Fig. 4 from Zhou et al., 2011
whole organism lacks all parts of type ventral aorta, abnormal WT + MO2-ltbp3 standard conditions text only from Zhou et al., 2011
presumptive cardiac ventricle heart tube decreased length, abnormal WT + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
whole organism mir145 expression decreased amount, abnormal WT + MO2-ltbp3 control Fig. 6 with image from Gays et al., 2017
bulbus arteriosus lacks all parts of type smooth muscle myoblast, abnormal WT + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
heart looping decreased process quality, abnormal WT + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
lateral plate mesoderm tissue migration decreased process quality, abnormal pd24Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
lateral plate mesoderm tissue migration decreased occurrence, abnormal pd24Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
pharyngeal vasculature malformed, abnormal s843Tg + MO2-ltbp3 standard conditions Fig. S6 from Zhou et al., 2011
pharyngeal vasculature hypoplastic, abnormal s843Tg + MO2-ltbp3 standard conditions Fig. S6 from Zhou et al., 2011
intestine smooth muscle mCherry expression decreased amount, abnormal uto5Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
intestine smooth muscle ab1-tagln labeling decreased amount, abnormal uto5Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
cardiac ventricle has fewer parts of type ventricular endocardium, abnormal y7Tg + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
cardiac ventricle physical object quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
cardiac ventricle morphogenesis decreased process quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
presumptive bulbus arteriosus hypoplastic, abnormal fb2Tg; fb7Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
outflow tract morphogenesis decreased process quality, abnormal fb2Tg; fb7Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
intestine smooth muscle cell decreased amount, abnormal s854Tg; uto5Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.