Morpholino

MO2-mbnl2

ID

ZDB-MRPHLNO-110622-2

Name

MO2-mbnl2

Previous Names

None

Target

mbnl2 (1)

Sequence

5' - GTTTGTGTGTTGCTGTACTTTTGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO. Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-mbnl2

No data available

Phenotype

Phenotype resulting from MO2-mbnl2

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
brain malformed, abnormal	WT + MO2-mbnl2	Fig. 5 , text only from Machuca-Tzili et al., 2011
eye decreased pigmentation, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
eye hypoplastic, abnormal	WT + MO2-mbnl2	Fig. 5 , text only from Machuca-Tzili et al., 2011
fourth ventricle increased size, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
heart dilated, abnormal	WT + MO2-mbnl2	Fig. 5 , text only from Machuca-Tzili et al., 2011
heart elongated, abnormal	WT + MO2-mbnl2	Fig. 5 , text only from Machuca-Tzili et al., 2011
heart hypoplastic, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
mechanosensory behavior disrupted, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
pericardium edematous, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
post-vent region decreased length, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
post-vent region kinked, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011
somite U-shaped, abnormal	WT + MO2-mbnl2	Fig. 5 , text only from Machuca-Tzili et al., 2011
whole organism decreased mobility, abnormal	WT + MO2-mbnl2	text only from Machuca-Tzili et al., 2011

Phenotype of all Fish created by or utilizing MO2-mbnl2

Phenotype	Fish	Conditions	Figures
heart elongated, abnormal	WT + MO2-mbnl2	standard conditions	Fig. 5 , text only from Machuca-Tzili et al., 2011
eye decreased pigmentation, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
blood circulation disrupted, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
fourth ventricle increased size, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
whole organism decreased mobility, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
heart hypoplastic, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
post-vent region decreased length, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
eye hypoplastic, abnormal	WT + MO2-mbnl2	standard conditions	Fig. 5 , text only from Machuca-Tzili et al., 2011
brain malformed, abnormal	WT + MO2-mbnl2	standard conditions	Fig. 5 , text only from Machuca-Tzili et al., 2011
somite U-shaped, abnormal	WT + MO2-mbnl2	standard conditions	Fig. 5 , text only from Machuca-Tzili et al., 2011
post-vent region kinked, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
mechanosensory behavior disrupted, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
pericardium edematous, abnormal	WT + MO2-mbnl2	standard conditions	text only from Machuca-Tzili et al., 2011
heart dilated, abnormal	WT + MO2-mbnl2	standard conditions	Fig. 5 , text only from Machuca-Tzili et al., 2011

Citations