Morpholino

MO1-mbnl2

ID
ZDB-MRPHLNO-110622-1
Name
MO1-mbnl2
Previous Names
None
Target
Sequence
5' - TAAAGCCATAGTTGTGTTGTGAATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mbnl2
Expressed Gene Anatomy Figures
clcn1b Fig. 4 with image from Machuca-Tzili et al., 2011
mbnl1 Fig. S5 with image from Machuca-Tzili et al., 2011
mbnl2 Fig. S5 with image from Machuca-Tzili et al., 2011
mbnl3 Fig. S5 with image from Machuca-Tzili et al., 2011
scn4ab Fig. S8 with image from Machuca-Tzili et al., 2011
tnnt2a Fig. 4 with image from Machuca-Tzili et al., 2011
Phenotype
Phenotype resulting from MO1-mbnl2
Phenotype Fish Figures
blood circulation disrupted, abnormal WT + MO1-mbnl2 Fig. 3 with image,  text only from Machuca-Tzili et al., 2011
brain malformed, abnormal WT + MO1-mbnl2 Fig. 2 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
cardiac muscle cell H zone absent, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
cardiac muscle cell I band absent, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
cardiac muscle cell Z disc irregular spatial pattern, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
eye decreased pigmentation, abnormal WT + MO1-mbnl2 Fig. 2 with image from Machuca-Tzili et al., 2011
eye hypoplastic, abnormal WT + MO1-mbnl2 Fig. 2 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
fast muscle cell decreased amount, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
fourth ventricle increased size, abnormal WT + MO1-mbnl2 Fig. 2 with image from Machuca-Tzili et al., 2011
heart dilated, abnormal WT + MO1-mbnl2 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
heart elongated, abnormal WT + MO1-mbnl2 Fig. 2 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
heart hypoplastic, abnormal WT + MO1-mbnl2 Fig. 2 with image from Machuca-Tzili et al., 2011
mechanosensory behavior disrupted, abnormal WT + MO1-mbnl2 text only from Machuca-Tzili et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
pericardium edematous, abnormal WT + MO1-mbnl2 Fig. 2 with image from Machuca-Tzili et al., 2011
post-vent region decreased length, abnormal WT + MO1-mbnl2 Fig. 2 with image from Machuca-Tzili et al., 2011
post-vent region kinked, abnormal WT + MO1-mbnl2 Fig. 2 with image from Machuca-Tzili et al., 2011
skeletal muscle cell H zone absent, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell I band absent, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell myofibril disorganized, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell sarcomere decreased length, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell Z disc irregular spatial pattern, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
slow muscle cell decreased amount, abnormal WT + MO1-mbnl2 Fig. 3 with image from Machuca-Tzili et al., 2011
somite U-shaped, abnormal WT + MO1-mbnl2 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
whole organism decreased mobility, abnormal WT + MO1-mbnl2 text only from Machuca-Tzili et al., 2011
Phenotype of all Fish created by or utilizing MO1-mbnl2
Phenotype Fish Conditions Figures
skeletal muscle cell sarcomere decreased length, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
whole organism decreased mobility, abnormal WT + MO1-mbnl2 standard conditions text only from Machuca-Tzili et al., 2011
heart dilated, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
skeletal muscle cell I band absent, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
fast muscle cell decreased amount, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
cardiac muscle cell H zone absent, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
post-vent region kinked, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image from Machuca-Tzili et al., 2011
slow muscle cell decreased amount, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell H zone absent, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
skeletal muscle cell Z disc irregular spatial pattern, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
mechanosensory behavior disrupted, abnormal WT + MO1-mbnl2 standard conditions text only from Machuca-Tzili et al., 2011
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
somite U-shaped, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
fourth ventricle increased size, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image from Machuca-Tzili et al., 2011
cardiac muscle cell I band absent, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
eye decreased pigmentation, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image from Machuca-Tzili et al., 2011
post-vent region decreased length, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image from Machuca-Tzili et al., 2011
pericardium edematous, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image from Machuca-Tzili et al., 2011
eye hypoplastic, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
heart hypoplastic, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image from Machuca-Tzili et al., 2011
blood circulation disrupted, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image,  text only from Machuca-Tzili et al., 2011
heart elongated, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
skeletal muscle cell myofibril disorganized, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
cardiac muscle cell Z disc irregular spatial pattern, abnormal WT + MO1-mbnl2 standard conditions Fig. 3 with image from Machuca-Tzili et al., 2011
brain malformed, abnormal WT + MO1-mbnl2 standard conditions Fig. 2 with image,  Fig. 5 with image from Machuca-Tzili et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.