Morpholino
MO3-trim33
- ID
- ZDB-MRPHLNO-110321-1
- Name
- MO3-trim33
- Previous Names
-
- tif1g MO (1)
- Target
- Sequence
-
5' - GCTCTCCGTACAATCTTGGCCTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-trim33
No data available
Phenotype
Phenotype resulting from MO3-trim33
No data available
Phenotype of all Fish created by or utilizing MO3-trim33
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| caudal vein plexus size, ameliorated | y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO3-trim33 | standard conditions |
Figure 4 
from Li et al., 2021 |
1 - 1 of 1
Citations
- Li, W., Tran, V., Shaked, I., Xue, B., Moore, T., Lightle, R., Kleinfeld, D., Awad, I.A., Ginsberg, M.H. (2021) Abortive intussusceptive angiogenesis causes multi-cavernous vascular malformations. eLIFE. 10:
- Weijts, B., Gutierrez, E., Saikin, S.K., Ablooglu, A.J., Traver, D., Groisman, A., Tkachenko, E. (2018) Blood flow-induced Notch activation and endothelial migration enable vascular remodeling in zebrafish embryos. Nature communications. 9:5314
- Qiu, J., Fan, X., Wang, Y., Jin, H., Song, Y., Han, Y., Huang, S., Meng, Y., Tang, F., Meng, A. (2016) Embryonic hematopoiesis in vertebrate somites gives rise to definitive hematopoietic stem cells. Journal of molecular cell biology. 8(4):288-301
- Monteiro, R., Pouget, C., and Patient, R. (2011) The gata1/pu.1 lineage fate paradigm varies between blood populations and is modulated by tif1γ. The EMBO journal. 30(6):1093-1103
1 - 4 of 4
Show