Morpholino

MO1-p4htmb

ID
ZDB-MRPHLNO-110131-4
Name
MO1-p4htmb
Previous Names
  • MO1-p4htm
  • TM1 (1)
Target
Sequence
5' - GTTCCATCATTTTGCCAGACAACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-p4htmb
Expressed Gene Anatomy Figures
col4a3 Fig. 3 from Hyvarinen et al., 2010
col18a1a Fig. 3 from Hyvarinen et al., 2010
egln1b Fig. 3 from Hyvarinen et al., 2010
egln2 Fig. 3 from Hyvarinen et al., 2010
egln3 Fig. 3 from Hyvarinen et al., 2010
epas1b Fig. 3 from Hyvarinen et al., 2010
epoa Fig. 3 from Hyvarinen et al., 2010
hif1ab Fig. 3 from Hyvarinen et al., 2010
ldha Fig. 3 from Hyvarinen et al., 2010
p4ha1a Fig. 3 from Hyvarinen et al., 2010
p4htmb Fig. 3 from Hyvarinen et al., 2010
slc2a16 Fig. 3 from Hyvarinen et al., 2010
vegfaa Fig. 3 from Hyvarinen et al., 2010
Phenotype
Phenotype resulting from MO1-p4htmb
Phenotype Fish Figures
eye decreased size, abnormal WT + MO1-p4htmb Fig. 4,  text only from Hyvarinen et al., 2010
glomerular filtration disrupted, abnormal WT + MO1-p4htmb Fig. 5 from Hyvarinen et al., 2010
head decreased size, abnormal WT + MO1-p4htmb Fig. 2 from Hyvarinen et al., 2010
lens opaque, abnormal WT + MO1-p4htmb Fig. 4,  text only from Hyvarinen et al., 2010
lens capsule basement membrane broken, abnormal WT + MO1-p4htmb Fig. 4 from Hyvarinen et al., 2010
lens capsule basement membrane decreased thickness, abnormal WT + MO1-p4htmb Fig. 4 from Hyvarinen et al., 2010
lens epithelium nucleus mislocalised, abnormal WT + MO1-p4htmb Fig. 4 from Hyvarinen et al., 2010
lens fiber cell development disrupted, abnormal WT + MO1-p4htmb Fig. 4 from Hyvarinen et al., 2010
pericardium edematous, abnormal WT + MO1-p4htmb Fig. 2,  text only from Hyvarinen et al., 2010
pronephric glomerular basement membrane broken, abnormal WT + MO1-p4htmb Fig. 5 from Hyvarinen et al., 2010
pronephric glomerular capsule dilated, abnormal WT + MO1-p4htmb Fig. 5 from Hyvarinen et al., 2010
pronephric podocyte decreased amount, abnormal WT + MO1-p4htmb Fig. 5 from Hyvarinen et al., 2010
pronephric podocyte shape, abnormal WT + MO1-p4htmb Fig. 5 from Hyvarinen et al., 2010
retina disorganized, abnormal WT + MO1-p4htmb Fig. 4 from Hyvarinen et al., 2010
Phenotype of all Fish created by or utilizing MO1-p4htmb
Phenotype Fish Conditions Figures
pronephric glomerular basement membrane broken, abnormal WT + MO1-p4htmb standard conditions Fig. 5 from Hyvarinen et al., 2010
head decreased size, abnormal WT + MO1-p4htmb standard conditions Fig. 2 from Hyvarinen et al., 2010
lens capsule basement membrane decreased thickness, abnormal WT + MO1-p4htmb standard conditions Fig. 4 from Hyvarinen et al., 2010
lens fiber cell development disrupted, abnormal WT + MO1-p4htmb standard conditions Fig. 4 from Hyvarinen et al., 2010
glomerular filtration disrupted, abnormal WT + MO1-p4htmb standard conditions Fig. 5 from Hyvarinen et al., 2010
pronephric podocyte shape, abnormal WT + MO1-p4htmb standard conditions Fig. 5 from Hyvarinen et al., 2010
pronephric podocyte decreased amount, abnormal WT + MO1-p4htmb standard conditions Fig. 5 from Hyvarinen et al., 2010
lens capsule basement membrane broken, abnormal WT + MO1-p4htmb standard conditions Fig. 4 from Hyvarinen et al., 2010
retina disorganized, abnormal WT + MO1-p4htmb standard conditions Fig. 4 from Hyvarinen et al., 2010
pronephric glomerular capsule dilated, abnormal WT + MO1-p4htmb standard conditions Fig. 5 from Hyvarinen et al., 2010
lens opaque, abnormal WT + MO1-p4htmb standard conditions Fig. 4,  text only from Hyvarinen et al., 2010
eye decreased size, abnormal WT + MO1-p4htmb standard conditions Fig. 4,  text only from Hyvarinen et al., 2010
lens epithelium nucleus mislocalised, abnormal WT + MO1-p4htmb standard conditions Fig. 4 from Hyvarinen et al., 2010
pericardium edematous, abnormal WT + MO1-p4htmb standard conditions Fig. 2,  text only from Hyvarinen et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.