Morpholino

MO1-apobb.1

ID
ZDB-MRPHLNO-101207-2
Name
MO1-apobb.1
Previous Names
  • MO1-apobl (1)
Target
Sequence
5' - CCATGATGGGTTCAGGTAAGCTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apobb.1
Phenotype
Phenotype resulting from MO1-apobb.1
Phenotype of all Fish created by or utilizing MO1-apobb.1
Phenotype Fish Conditions Figures
optic stalk increased thickness, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
retinal ganglion cell decreased amount, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
optic stalk decreased length, abnormal AB + MO1-apobb.1 standard conditions Fig. 7 with image from Seth et al., 2010
liver bilaterally paired, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
liver hepatocyte has extra parts of type hepatocyte lipid droplet, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 4 with image from Templehof et al., 2021
liver tfa expression spatial pattern, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
liver fatty, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal apobawz26/wz26 + MO1-apobb.1 chemical treatment by environment: oleate Figure 4 with image from Templehof et al., 2021
determination of liver left/right asymmetry decreased process quality, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 4 with image from Templehof et al., 2021
intestinal epithelium has fewer parts of type goblet cell, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 3 with image from Templehof et al., 2021
liver prox1a expression spatial pattern, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis occurrence, ameliorated apobawz26/wz26 + MO1-apobb.1 chemical treatment by injection: low-density lipoprotein Figure 4 with image from Templehof et al., 2021
subintestinal venous plexus has number of subintestinal venous plexus angiogenic sprout, ameliorated apobawz26/wz26 + MO1-apobb.1 chemical treatment by injection: low-density lipoprotein Figure 4 with image from Templehof et al., 2021
liver fabp10a expression decreased amount, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal apobawz26/wz26 + MO1-apobb.1 chemical treatment by environment: oleate Figure 4 with image from Templehof et al., 2021
whole organism cholesterol decreased amount, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 1 with image from Templehof et al., 2021
liver decreased size, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
whole organism triglyceride decreased amount, abnormal apobawz26/wz26 + MO1-apobb.1 standard conditions Figure 1 with image from Templehof et al., 2021
liver EGFP expression decreased amount, abnormal apobawz26/wz26; as3Tg + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
liver decreased size, abnormal apobawz26/wz26; as3Tg + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
liver Notch signaling pathway decreased occurrence, abnormal apobawz26/wz26; ia12Tg + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
intestine EGFP expression increased amount, abnormal apobawz26/wz26; ia12Tg + MO1-apobb.1 standard conditions Figure 3 with image from Templehof et al., 2021
liver EGFP expression decreased amount, abnormal apobawz26/wz26; ia12Tg + MO1-apobb.1 standard conditions Figure 2 with image from Templehof et al., 2021
intestine Notch signaling pathway increased occurrence, abnormal apobawz26/wz26; ia12Tg + MO1-apobb.1 standard conditions Figure 3 with image from Templehof et al., 2021
subintestinal venous plexus Notch signaling pathway increased occurrence, abnormal apobawz26/wz26; ia12Tg; um13Tg + MO1-apobb.1 standard conditions Figure 4 with image from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal apobawz26/wz26; ia12Tg; um13Tg + MO1-apobb.1 standard conditions Figure 4 with image from Templehof et al., 2021
intestine lumen increased diameter, abnormal apobawz26/wz26; pd1034Tg + MO1-apobb.1 standard conditions Figure 3 with image from Templehof et al., 2021
intestinal epithelium has fewer parts of type intestinal epithelium microvillus, abnormal apobawz26/wz26; pd1034Tg + MO1-apobb.1 standard conditions Figure 3 with image from Templehof et al., 2021
intestine shape, abnormal apobawz26/wz26; pd1034Tg + MO1-apobb.1 standard conditions Figure 3 with image from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal apobawz26/wz26; y1Tg + MO1-apobb.1 standard conditions Figure 4 with image from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal apobawz26/wz26; y1Tg + MO1-apobb.1 standard conditions Figure 4 with image from Templehof et al., 2021
Citations