Morpholino

MO2-atp2b1a

ID
ZDB-MRPHLNO-101206-1
Name
MO2-atp2b1a
Previous Names
None
Target
Sequence
5' - CCATGTCTCCCGACCACACCTTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atp2b1a
Expressed Gene Anatomy Figures
atoh1a Fig. 5 from Go et al., 2010
epcam Fig. 5 from Go et al., 2010
sox2 Fig. 5 from Go et al., 2010
Phenotype
Phenotype resulting from MO2-atp2b1a
Phenotype Fish Figures
bone mineralization disrupted, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
ceratobranchial cartilage ossification absent, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
ceratobranchial cartilage ossification disrupted, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
dental epithelium lacks parts or has fewer parts of type tooth placode, abnormal sqet4Et + MO2-atp2b1a Fig. 3 from Go et al., 2013
hair cell posterior macula absent, abnormal sqet4Et + MO2-atp2b1a Fig. 4 from Go et al., 2010
neuromast hair cell has fewer parts of type neuromast hair cell kinocilium, abnormal sqet4Et + MO2-atp2b1a Fig. 3 from Go et al., 2010
neuromast hair cell has fewer parts of type neuromast hair cell stereocilium, abnormal sqet4Et + MO2-atp2b1a Fig. 3 from Go et al., 2010
neuromast hair cell kinocilium truncated, abnormal sqet4Et + MO2-atp2b1a Fig. 3 from Go et al., 2010
opercle decreased size, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
opercle shape, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
opercle bone mineralization decreased area, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
otolith decreased size, abnormal sqet4Et + MO2-atp2b1a Fig. 4 from Go et al., 2010
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal sqet4Et + MO2-atp2b1a Fig. 2 from Go et al., 2010
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal sqet4Et + MO2-atp2b1a Fig. 2 from Go et al., 2010
sensory perception of sound decreased occurrence, abnormal sqet4Et + MO2-atp2b1a Fig. 4 from Go et al., 2010
tooth 4V tooth mineralization absent, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
tooth 4V tooth mineralization disrupted, abnormal zf131Tg + MO2-atp2b1a Fig. 4 from Go et al., 2013
tooth mineralization decreased process quality, abnormal sqet4Et + MO2-atp2b1a Fig. 3 from Go et al., 2013
Phenotype of all Fish created by or utilizing MO2-atp2b1a
Phenotype Fish Conditions Figures
tooth mineralization decreased process quality, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 3 from Go et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 2 from Go et al., 2010
hair cell posterior macula absent, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2010
neuromast hair cell kinocilium truncated, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 3 from Go et al., 2010
sensory perception of sound decreased occurrence, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2010
otolith decreased size, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2010
neuromast hair cell has fewer parts of type neuromast hair cell kinocilium, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 3 from Go et al., 2010
neuromast hair cell has fewer parts of type neuromast hair cell stereocilium, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 3 from Go et al., 2010
dental epithelium lacks parts or has fewer parts of type tooth placode, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 3 from Go et al., 2013
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal sqet4Et + MO2-atp2b1a standard conditions Fig. 2 from Go et al., 2010
bone mineralization disrupted, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
opercle bone mineralization decreased area, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
tooth 4V tooth mineralization disrupted, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
opercle decreased size, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
ceratobranchial cartilage ossification disrupted, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
ceratobranchial cartilage ossification absent, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
tooth 4V tooth mineralization absent, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
opercle shape, abnormal zf131Tg + MO2-atp2b1a standard conditions Fig. 4 from Go et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.