Morpholino

MO1-itgav

ID
ZDB-MRPHLNO-101102-1
Name
MO1-itgav
Previous Names
  • αV1
Target
Sequence
5' - AGTGTTTGCCCATGTTTTGAGTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itgav
Phenotype
Phenotype resulting from MO1-itgav
Phenotype Fish Figures
caudal vein ventral region decreased diameter, abnormal s843Tg + MO1-itgav Fig. S6 from Nikolic et al., 2013
caudal vein plexus ventral region decreased diameter, abnormal s843Tg + MO1-itgav Fig. S6 from Nikolic et al., 2013
cell migration involved in gastrulation disrupted, abnormal WT + MO1-itgav Fig. 3 with image from Ablooglu et al., 2010
cerebellum malformed, abnormal WT + MO1-itgav Fig. 2 with image from Ablooglu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-itgav Fig. 1 with imageFig. 2 with image from Ablooglu et al., 2010
forerunner cell group circular, abnormal ha01Tg + MO1-itgav Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal ha01Tg + MO1-itgav Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal ha01Tg + MO1-itgav Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal WT + MO1-itgav Fig. 3 with imageFig. 5 with image from Ablooglu et al., 2010
forerunner cell group stratification, abnormal WT + MO1-itgav Fig. 3 with image from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal ha01Tg + MO1-itgav Fig. 5 with image from Ablooglu et al., 2010
fourth ventricle increased accumulation cerebral spinal fluid, abnormal WT + MO1-itgav Fig. 2 with image from Ablooglu et al., 2010
heart tube positional polarity, abnormal WT + MO1-itgav Fig. 1 with imageFig. 2 with image from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal WT + MO1-itgav Fig. 7 with image from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal ha01Tg + MO1-itgav Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-itgav Fig. 7 with imageFig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal ha01Tg + MO1-itgav Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal ha01Tg + MO1-itgav Fig. 8 with image from Ablooglu et al., 2010
pericardium edematous, abnormal WT + MO1-itgav Fig. 2 with image from Ablooglu et al., 2010
Phenotype of all Fish created by or utilizing MO1-itgav
Phenotype Fish Conditions Figures
heart tube positional polarity, abnormal WT + MO1-itgav standard conditions Fig. 1 with imageFig. 2 with image from Ablooglu et al., 2010
pericardium edematous, abnormal WT + MO1-itgav standard conditions Fig. 2 with image from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal WT + MO1-itgav standard conditions Fig. 7 with image from Ablooglu et al., 2010
cell migration involved in gastrulation disrupted, abnormal WT + MO1-itgav standard conditions Fig. 3 with image from Ablooglu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-itgav standard conditions Fig. 1 with imageFig. 2 with image from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal WT + MO1-itgav standard conditions Fig. 3 with image from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-itgav standard conditions Fig. 7 with image from Ablooglu et al., 2010
forerunner cell group stratification, abnormal WT + MO1-itgav standard conditions Fig. 3 with image from Ablooglu et al., 2010
cerebellum malformed, abnormal WT + MO1-itgav standard conditions Fig. 2 with image from Ablooglu et al., 2010
fourth ventricle increased accumulation cerebral spinal fluid, abnormal WT + MO1-itgav standard conditions Fig. 2 with image from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal ha01Tg + MO1-itgav standard conditions Fig. 8 with image from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal ha01Tg + MO1-itgav standard conditions Fig. 5 with image from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal ha01Tg + MO1-itgav standard conditions Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal ha01Tg + MO1-itgav standard conditions Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal ha01Tg + MO1-itgav standard conditions Fig. 8 with image from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal ha01Tg + MO1-itgav standard conditions Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group circular, abnormal ha01Tg + MO1-itgav standard conditions Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal ha01Tg + MO1-itgav standard conditions Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal ha01Tg + MO1-itgav standard conditions Fig. 5 with image from Ablooglu et al., 2010
caudal vein ventral region decreased diameter, abnormal s843Tg + MO1-itgav standard conditions Fig. S6 from Nikolic et al., 2013
caudal vein plexus ventral region decreased diameter, abnormal s843Tg + MO1-itgav standard conditions Fig. S6 from Nikolic et al., 2013
forerunner cell group disorganized, abnormal ha01Tg + MO1-fermt2 + MO1-itgav standard conditions Fig. 3 from Fitzpatrick et al., 2014
forerunner cell group disorganized, abnormal ha01Tg + MO1-itgav + MO2-fermt2 standard conditions Fig. 3 from Fitzpatrick et al., 2014
Citations