Morpholino

MO1-tmem216

ID

ZDB-MRPHLNO-100818-1

Name

MO1-tmem216

Previous Names

None

Target

tmem216 (1)

Sequence

5' - GGTTGTCTTCCGTGGGCAGCCATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

blocks translation

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tmem216

No data available

Phenotype

Phenotype resulting from MO1-tmem216

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	AB + MO1-tmem216	Fig. 4 from Lee et al., 2012
gastrulation process quality, abnormal	AB + MO1-tmem216	Fig. S18 from Lee et al., 2012
heart position, abnormal	twu34Tg + MO1-tmem216	Fig. S17 from Lee et al., 2012
notochord increased width, abnormal	WT + MO1-tmem216	Fig. 5 from Valente et al., 2010
notochord kinked, abnormal	AB + MO1-tmem216	Fig. S18 from Lee et al., 2012
pericardium edematous, abnormal	AB + MO1-tmem216	Fig. 4 from Lee et al., 2012
post-vent region curved, abnormal	AB + MO1-tmem216	Fig. 4 from Lee et al., 2012
post-vent region kinked, abnormal	AB + MO1-tmem216	Fig. 4 from Lee et al., 2012
somite morphology, abnormal	WT + MO1-tmem216	Fig. 5 from Valente et al., 2010
whole organism decreased length, abnormal	AB + MO1-tmem216	Fig. S18 from Lee et al., 2012
whole organism anterior region decreased size, abnormal	AB + MO1-tmem216	Fig. S18 from Lee et al., 2012
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-tmem216	Fig. 5 from Valente et al., 2010

Phenotype of all Fish created by or utilizing MO1-tmem216

Phenotype	Fish	Conditions	Figures
post-vent region curved, abnormal	AB + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
notochord kinked, abnormal	AB + MO1-tmem216	standard conditions	Fig. S18 from Lee et al., 2012
post-vent region kinked, abnormal	AB + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
pericardium edematous, abnormal	AB + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
whole organism anterior region decreased size, abnormal	AB + MO1-tmem216	standard conditions	Fig. S18 from Lee et al., 2012
whole organism decreased length, abnormal	AB + MO1-tmem216	standard conditions	Fig. S18 from Lee et al., 2012
gastrulation process quality, abnormal	AB + MO1-tmem216	standard conditions	Fig. S18 from Lee et al., 2012
brain hydrocephalic, abnormal	AB + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-tmem216	standard conditions	Fig. 5 from Valente et al., 2010
somite morphology, abnormal	WT + MO1-tmem216	standard conditions	Fig. 5 from Valente et al., 2010
notochord increased width, abnormal	WT + MO1-tmem216	standard conditions	Fig. 5 from Valente et al., 2010
heart position, abnormal	twu34Tg + MO1-tmem216	standard conditions	Fig. S17 from Lee et al., 2012
post-vent region curved, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
post-vent region kinked, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
pericardium edematous, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
brain hydrocephalic, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
whole organism viability, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
heart position, abnormal	twu34Tg + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. S17 from Lee et al., 2012

Citations