Morpholino

MO1-and1

ID

ZDB-MRPHLNO-100804-4

Name

MO1-and1

Previous Names

None

Target

and1 (1)

Sequence

5' - GGAAGATCCTCTCAAATGAGCCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-and1

Expressed Gene	Anatomy	Figures
and1	whole organism	Fig. 3 from Zhang et al., 2010

Phenotype

Phenotype resulting from MO1-and1

No data available

Phenotype of all Fish created by or utilizing MO1-and1

Phenotype	Fish	Conditions	Figures
median fin fold actinotrichium aplastic, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
actinotrichium aplastic, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
pectoral fin fold decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
regenerating fin actinotrichium disorganized, abnormal	WT + MO1-and1 + MO1-and2	amputation: fin	Fig. 3 from Zhang et al., 2010
median fin fold actinotrichium absent, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
cartilage development involved in endochondral bone morphogenesis delayed, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S8 from Zhang et al., 2010
hindbrain deformed, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
scapulocoracoid upper region aplastic, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S8 from Zhang et al., 2010
median fin fold granular, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3, Fig. S6 from Zhang et al., 2010
median fin fold decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3, Fig. S6 from Zhang et al., 2010
pericardium edematous, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
eye decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
cartilage development delayed, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S8 from Zhang et al., 2010
head decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
actinotrichium absent, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
median fin fold curled, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3, Fig. S6 from Zhang et al., 2010
pectoral fin fold absent, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
actinotrichium decreased amount, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
median fin fold filopodium disoriented, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
pectoral fin fold filopodium absent, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
median fin fold mesenchymal cell disorganized, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
pectoral fin fold mesenchymal cell absent, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010

Citations