Morpholino

MO1-cactin

ID
ZDB-MRPHLNO-100726-2
Name
MO1-cactin
Previous Names
  • Cactin-MO (1)
  • E2I2 MO (1)
Target
Sequence
5' - ACCGTATATCATATCTCTCACCTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Morpholino targeting the second intron of cactin.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cactin
No data available
Phenotype
Phenotype resulting from MO1-cactin
Phenotype Fish Figures
eye apoptotic, abnormal WT + MO1-cactin Fig. 5 with image from Atzei et al., 2010
eye decreased size, abnormal WT + MO1-cactin Fig. 3 with image,  Fig. 5 with image from Atzei et al., 2010
eye spherical, abnormal WT + MO1-cactin Fig. 5 with image from Atzei et al., 2010
head circular, abnormal WT + MO1-cactin Fig. 3 with image from Atzei et al., 2010
oral cavity decreased size, abnormal WT + MO1-cactin Fig. 5 with image from Atzei et al., 2010
photoreceptor outer segment layer disheveled, abnormal WT + MO1-cactin Fig. 5 with image from Atzei et al., 2010
post-vent region decreased length, abnormal WT + MO1-cactin Fig. 4 with image from Atzei et al., 2010
retina layer formation disrupted, abnormal WT + MO1-cactin Fig. 5 with image from Atzei et al., 2010
retinal neural layer stratification, abnormal WT + MO1-cactin Fig. 5 with image from Atzei et al., 2010
whole organism bent, abnormal WT + MO1-cactin Fig. 3 with image,  Fig. 4 with image from Atzei et al., 2010
whole organism decreased length, abnormal WT + MO1-cactin Fig. 3 with image from Atzei et al., 2010
whole organism viability, abnormal WT + MO1-cactin Fig. 4 with image from Atzei et al., 2010
Phenotype of all Fish created by or utilizing MO1-cactin
Phenotype Fish Conditions Figures
photoreceptor outer segment layer disheveled, abnormal WT + MO1-cactin standard conditions Fig. 5 with image from Atzei et al., 2010
retinal neural layer stratification, abnormal WT + MO1-cactin standard conditions Fig. 5 with image from Atzei et al., 2010
whole organism viability, abnormal WT + MO1-cactin standard conditions Fig. 4 with image from Atzei et al., 2010
head circular, abnormal WT + MO1-cactin standard conditions Fig. 3 with image from Atzei et al., 2010
retina layer formation disrupted, abnormal WT + MO1-cactin standard conditions Fig. 5 with image from Atzei et al., 2010
eye apoptotic, abnormal WT + MO1-cactin standard conditions Fig. 5 with image from Atzei et al., 2010
whole organism decreased length, abnormal WT + MO1-cactin standard conditions Fig. 3 with image from Atzei et al., 2010
whole organism bent, abnormal WT + MO1-cactin standard conditions Fig. 3 with image,  Fig. 4 with image from Atzei et al., 2010
eye spherical, abnormal WT + MO1-cactin standard conditions Fig. 5 with image from Atzei et al., 2010
eye decreased size, abnormal WT + MO1-cactin standard conditions Fig. 3 with image,  Fig. 5 with image from Atzei et al., 2010
oral cavity decreased size, abnormal WT + MO1-cactin standard conditions Fig. 5 with image from Atzei et al., 2010
post-vent region decreased length, abnormal WT + MO1-cactin standard conditions Fig. 4 with image from Atzei et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.