Morpholino
MO4-vegfc
- ID
- ZDB-MRPHLNO-100707-6
- Name
- MO4-vegfc
- Previous Names
-
- vegfcMO2 (1)
- Target
- Sequence
-
5' - ACTTTGACTCACCGTCTTGCTGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-vegfc
No data available
Phenotype
Phenotype resulting from MO4-vegfc
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO4-vegfc
1 - 4 of 4
Citations
- Baeyens, N., Nicoli, S., Coon, B.G., Ross, T.D., Van den Dries, K., Han, J., Lauridsen, H.M., Mejean, C.O., Eichmann, A., Thomas, J.L., Humphrey, J.D., Schwartz, M.A. (2015) Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point. eLIFE. 4
- Astin, J.W., Haggerty, M.J., Okuda, K.S., Le Guen, L., Misa, J.P., Tromp, A., Hogan, B.M., Crosier, K.E., Crosier, P.S. (2014) Vegfd can compensate for loss of Vegfc in zebrafish facial lymphatic sprouting. Development (Cambridge, England). 141(13):2680-90
- Kwon, H.B., Fukuhara, S., Asakawa, K., Ando, K., Kashiwada, T., Kawakami, K., Hibi, M., Kwon, Y.G., Kim, K.W., Alitalo, K., and Mochizuki, N. (2013) The parallel growth of motoneuron axons with the dorsal aorta depends on Vegfc/Vegfr3 signaling in zebrafish. Development (Cambridge, England). 140(19):4081-4090
- Villefranc, J.A., Nicoli, S., Bentley, K., Jeltsch, M., Zarkada, G., Moore, J.C., Gerhardt, H., Alitalo, K., and Lawson, N.D. (2013) A truncation allele in vascular endothelial growth factor c reveals distinct modes of signaling during lymphatic and vascular development. Development (Cambridge, England). 140(7):1497-1506
- Flores, M.V., Hall, C.J., Crosier, K.E., and Crosier, P.S. (2010) Visualization of embryonic lymphangiogenesis advances the use of the zebrafish model for research in cancer and lymphatic pathologies. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(7):2128-2135
1 - 5 of 5
Show