Morpholino

MO2-hmx3a

ID
ZDB-MRPHLNO-100602-4
Name
MO2-hmx3a
Previous Names
None
Target
Sequence
5' - CATGTTGGCTTGATATTCGGGTTTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hmx3a
No data available
Phenotype
Phenotype resulting from MO2-hmx3a
Phenotype of all Fish created by or utilizing MO2-hmx3a
Phenotype Fish Conditions Figures
whole organism balance, abnormal AB + MO2-hmx3a standard conditions text only from Feng et al., 2010
whole organism decreased coordination, abnormal AB + MO2-hmx3a standard conditions text only from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal AB + MO2-hmx3a standard conditions text only from Feng et al., 2010
otolith fused with otolith, abnormal AB + MO2-hmx3a standard conditions text only from Feng et al., 2010
lapillus fused with sagitta, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
posterior lateral line neuromast decreased amount, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 6 with imagetext only from Feng et al., 2010
lapillus mislocalised, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
hair cell anterior macula decreased amount, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
macula neuromast hair cell decreased amount, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
startle response disrupted, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
otolith located in saccule, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
semicircular canal decreased size, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
vestibular reflex disrupted, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
neuromuscular process controlling balance disrupted, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
posterior lateral line neuromast absent, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with imageFig. 6 with imagetext only from Feng et al., 2010
anterior macula mislocalised posteriorly, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
inner ear decreased size, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 2 with image from Feng et al., 2010
anterior macula fused with posterior macula, abnormal AB + MO1-hmx2 + MO2-hmx3a standard conditions Fig. 3 with image from Feng et al., 2010
Citations