Morpholino

MO2-apc

ID
ZDB-MRPHLNO-100507-5
Name
MO2-apc
Previous Names
  • apc1 MO (1)
Target
Sequence
5' - TGCAGCCATCTTGAACTATCTCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-apc
No data available
Phenotype
Phenotype resulting from MO2-apc
Phenotype of all Fish created by or utilizing MO2-apc
Phenotype Fish Conditions Figures
eye decreased size, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
somite flattened, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
whole organism decreased length, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
diencephalon flattened, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
optic tectum flattened, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
midbrain hindbrain boundary morphology, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
optic tectum decreased size, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
otic vesicle increased size, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
diencephalon decreased size, abnormal apczf134/zf134 + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
diencephalon decreased size, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
optic tectum flattened, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
otic vesicle increased size, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
optic tectum decreased size, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
diencephalon flattened, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
midbrain hindbrain boundary morphology, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
eye decreased size, abnormal WT + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
optic tectum flattened, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
diencephalon flattened, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
otic vesicle increased size, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
diencephalon decreased size, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
eye decreased size, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
midbrain hindbrain boundary morphology, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
optic tectum decreased size, abnormal apczf134/+ + MO2-apc standard conditions Fig. 1 with image from Paridaen et al., 2009
Citations