Morpholino

MO1-gbx1

ID
ZDB-MRPHLNO-100429-3
Name
MO1-gbx1
Previous Names
  • gbx1-MO (1)
Target
Sequence
5' - AAATCCCGTGCTGTACTGGCCTTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gbx1
Expressed Gene Anatomy Figures
cdx4 Fig. 6 with image from Rhinn et al., 2009
egr2b Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Rhinn et al., 2009
fgf8a Fig. 6 with image from Rhinn et al., 2009
hoxb1a Fig. 6 with image from Rhinn et al., 2009
hoxb1b Fig. 6 with image from Rhinn et al., 2009
mafba Fig. 6 with image from Rhinn et al., 2009
myod1 Fig. 5 with image,  Fig. S2 with image from Rhinn et al., 2009
otx2b Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Rhinn et al., 2009
pax2a Fig. 6 with image from Rhinn et al., 2009
Phenotype
Phenotype resulting from MO1-gbx1
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
gastrulation delayed, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
hindbrain anterior region decreased size, abnormal WT + MO1-gbx1 Fig. 5 with image from Rhinn et al., 2009
hindbrain anterior-posterior axis decreased length, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
midbrain hindbrain boundary neural keel morphology, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
midbrain hindbrain boundary neural plate mislocalised posteriorly, abnormal WT + MO1-gbx1 Fig. 6 with image from Rhinn et al., 2009
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO1-gbx1 Fig. 6 with image from Rhinn et al., 2009
neural keel wholly anteriorized, abnormal WT + MO1-gbx1 Fig. 5 with image from Rhinn et al., 2009
neural plate wholly anteriorized, abnormal WT + MO1-gbx1 Fig. 6 with image from Rhinn et al., 2009
spinal cord decreased length, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
spinal cord neural keel decreased length, abnormal WT + MO1-gbx1 Fig. 5 with image from Rhinn et al., 2009
whole organism necrotic, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
whole organism shape, abnormal WT + MO1-gbx1 Fig. S1 with image from Rhinn et al., 2009
Phenotype of all Fish created by or utilizing MO1-gbx1
Phenotype Fish Conditions Figures
neural plate wholly anteriorized, abnormal WT + MO1-gbx1 standard conditions Fig. 6 with image from Rhinn et al., 2009
gastrulation delayed, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
spinal cord decreased length, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
brain morphology, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
hindbrain anterior region decreased size, abnormal WT + MO1-gbx1 standard conditions Fig. 5 with image from Rhinn et al., 2009
spinal cord neural keel decreased length, abnormal WT + MO1-gbx1 standard conditions Fig. 5 with image from Rhinn et al., 2009
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO1-gbx1 standard conditions Fig. 6 with image from Rhinn et al., 2009
midbrain hindbrain boundary neural keel morphology, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
neural keel wholly anteriorized, abnormal WT + MO1-gbx1 standard conditions Fig. 5 with image from Rhinn et al., 2009
midbrain hindbrain boundary neural plate mislocalised posteriorly, abnormal WT + MO1-gbx1 standard conditions Fig. 6 with image from Rhinn et al., 2009
whole organism shape, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
whole organism necrotic, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
hindbrain anterior-posterior axis decreased length, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.