Morpholino

MO1-f2

ID
ZDB-MRPHLNO-100428-7
Name
MO1-f2
Previous Names
None
Target
Sequence
5' - GTTTGGCTCCCATCCTTGAGAGTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-f2
Expressed Gene Anatomy Figures
anxa1a Fig. 3 from Day et al., 2009
cldne Fig. 3 from Day et al., 2009
col1a2 Fig. 3 from Day et al., 2009
gatd3l Fig. 3 from Day et al., 2009
hbbe1.1 Fig. 3 from Day et al., 2009
mdm2 Fig. 3 from Day et al., 2009
phlda3 Fig. 3,  Fig. 4,  Fig. 5 from Day et al., 2009
rbp4 Fig. 3 from Day et al., 2009
sox21a Fig. 4,  Fig. 5 from Day et al., 2009
sox21b Fig. 4 from Day et al., 2009
tnni2a.1 Fig. 3 from Day et al., 2009
Phenotype
Phenotype resulting from MO1-f2
Phenotype Fish Figures
endoderm phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
extension decreased size, abnormal WT + MO1-f2 Fig. 1 from Day et al., 2009
forebrain phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain hindbrain boundary sox21a expression decreased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain hindbrain boundary constriction absent, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
pharyngeal arch 3-7 phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
post-vent region morphology, abnormal WT + MO1-f2 Fig. 1 from Day et al., 2009
tail bud phlda3 expression mislocalised, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
trunk morphology, abnormal WT + MO1-f2 Fig. 1 from Day et al., 2009
whole organism rbp4 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism hbbe1.1 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism col1a2 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism sox21a expression decreased amount, abnormal WT + MO1-f2 Fig. 4 from Day et al., 2009
whole organism sox21b expression decreased amount, abnormal WT + MO1-f2 Fig. 4 from Day et al., 2009
whole organism tnni2a.1 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism cldne expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism mdm2 expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism gatd3l expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 3,  Fig. 4 from Day et al., 2009
whole organism anxa1a expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
Phenotype of all Fish created by or utilizing MO1-f2
Phenotype Fish Conditions Figures
whole organism mdm2 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism sox21b expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 4 from Day et al., 2009
pharyngeal arch 3-7 phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
endoderm phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3,  Fig. 4 from Day et al., 2009
trunk morphology, abnormal WT + MO1-f2 standard conditions Fig. 1 from Day et al., 2009
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism hbbe1.1 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism gatd3l expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism cldne expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism anxa1a expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism rbp4 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism tnni2a.1 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
tail bud phlda3 expression mislocalised, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
midbrain hindbrain boundary constriction absent, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
midbrain phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
extension decreased size, abnormal WT + MO1-f2 standard conditions Fig. 1 from Day et al., 2009
whole organism sox21a expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 4 from Day et al., 2009
forebrain phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism col1a2 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
post-vent region morphology, abnormal WT + MO1-f2 standard conditions Fig. 1 from Day et al., 2009
midbrain hindbrain boundary sox21a expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
blood coagulation disrupted, abnormal la2Tg + MO1-f2 physical alteration: posterior cardinal vein Fig. 1 from Tournoij et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.