Morpholino

MO3-rx1

ID
ZDB-MRPHLNO-100423-2
Name
MO3-rx1
Previous Names
  • rx1 ATG-MO (1)
Target
Sequence
5' - TCATGGTGTCCAGTGACAAATGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-rx1
No data available
Phenotype
Phenotype resulting from MO3-rx1
No data available
Phenotype of all Fish created by or utilizing MO3-rx1
Phenotype Fish Conditions Figures
retinal outer nuclear layer decreased thickness, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina apoptotic, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 6 with image from Nelson et al., 2009
retina lacks all parts of type Muller cell, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina layer formation delayed, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
neural retina development disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 5 with image from Nelson et al., 2009
neural retina development delayed, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 4 with image from Nelson et al., 2009
retinal cone cell differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with imageFig. 2 with image from Nelson et al., 2009
cell population proliferation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 5 with image from Nelson et al., 2009
cell death increased occurrence, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 6 with image from Nelson et al., 2009
retinal rod cell differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina layer formation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with imageFig. 2 with image from Nelson et al., 2009
retina decreased size, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retinal bipolar neuron differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
eye photoreceptor cell differentiation disrupted, abnormal WT + MO2-rx1 + MO2-rx2 + MO3-rx1 + MO3-rx2 standard conditions Fig. 11 with image from Nelson et al., 2009
Citations