Morpholino

MO1-grk5

ID
ZDB-MRPHLNO-100308-3
Name
MO1-grk5
Previous Names
  • zGRK5 MO1 (1)
Target
Sequence
5' - TCGCTGCCATTGTTTCGATCTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-grk5
Expressed Gene Anatomy Figures
axin2 Fig. 4 from Chen et al., 2009
cdh5 Fig. 6 from Philipp et al., 2014
cdx4 Fig. 5 from Chen et al., 2009
ctnnb1 Fig. 4 from Chen et al., 2009
efnb2a Fig. 6 from Philipp et al., 2014
flt4 Fig. 6 from Philipp et al., 2014
grk5 Fig. 4 from Chen et al., 2009
myh6 Fig. 1 from Philipp et al., 2014
myh7 Fig. 1,  Fig. 9 from Philipp et al., 2014
myl7 Fig. 1,  Fig. 9 from Philipp et al., 2014
nkx2.2a Fig. 11 from Philipp et al., 2014
nkx2.5 Fig. 9 from Philipp et al., 2014
ptch2 Fig. 11 from Philipp et al., 2014
vent Fig. 5 from Chen et al., 2009
Phenotype
Phenotype resulting from MO1-grk5
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-grk5 Fig. 4 from Chen et al., 2009
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO1-grk5 Fig. 4 from Chen et al., 2009
heart decreased size, abnormal WT + MO1-grk5 Fig. 1,  Fig. 8 from Philipp et al., 2014
heart malformed, abnormal WT + MO1-grk5 Fig. S1 with image from Burkhalter et al., 2013
heart contraction decreased rate, abnormal WT + MO1-grk5 Fig. 1,  Fig. 10 from Philipp et al., 2014
heart development disrupted, abnormal WT + MO1-grk5 Fig. 8 from Philipp et al., 2014
heart looping decreased process quality, abnormal WT + MO1-grk5 Fig. S1 with image from Burkhalter et al., 2013
heart primordium decreased size, abnormal WT + MO1-grk5 Fig. 9 from Philipp et al., 2014
pericardium edematous, abnormal WT + MO1-grk5 Fig. 1,  Fig. 8,  Fig. 10,  Fig. 11 from Philipp et al., 2014
regulation of heart contraction disrupted, abnormal WT + MO1-grk5 Fig. 1,  Fig. 10 from Philipp et al., 2014
Phenotype of all Fish created by or utilizing MO1-grk5
Phenotype Fish Conditions Figures
heart development disrupted, abnormal WT + MO1-grk5 standard conditions Fig. 8 from Philipp et al., 2014
heart looping decreased process quality, abnormal WT + MO1-grk5 standard conditions Fig. S1 with image from Burkhalter et al., 2013
heart decreased size, abnormal WT + MO1-grk5 standard conditions Fig. 1,  Fig. 8 from Philipp et al., 2014
heart primordium decreased size, abnormal WT + MO1-grk5 standard conditions Fig. 9 from Philipp et al., 2014
pericardium edematous, abnormal WT + MO1-grk5 standard conditions Fig. 1,  Fig. 8,  Fig. 10,  Fig. 11 from Philipp et al., 2014
brain morphology, abnormal WT + MO1-grk5 standard conditions Fig. 4 from Chen et al., 2009
regulation of heart contraction disrupted, abnormal WT + MO1-grk5 standard conditions Fig. 1,  Fig. 10 from Philipp et al., 2014
heart malformed, abnormal WT + MO1-grk5 standard conditions Fig. S1 with image from Burkhalter et al., 2013
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO1-grk5 standard conditions Fig. 4 from Chen et al., 2009
heart contraction decreased rate, abnormal WT + MO1-grk5 standard conditions Fig. 1,  Fig. 10 from Philipp et al., 2014
heart looping decreased process quality, abnormal WT + MO1-grk5 + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
heart malformed, abnormal WT + MO1-grk5 + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.