Morpholino

MO1-uchl3

ID
ZDB-MRPHLNO-100225-31
Name
MO1-uchl3
Previous Names
None
Target
Sequence
5' - CTGGCCCTCCATCTCAGATTAAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-uchl3
Expressed Gene Anatomy Figures
elavl3 Fig. 1 with image from Tse et al., 2009
sox9a Fig. 5 from Tse, 2017
Phenotype
Phenotype resulting from MO1-uchl3
Phenotype Fish Figures
ethmoid cartilage absent, abnormal AB + MO1-uchl3 Fig. 4 from Tse, 2017
ethmoid cartilage sox9a expression decreased distribution, abnormal AB + MO1-uchl3 Fig. 5 from Tse, 2017
mandibular arch skeleton decreased size, abnormal AB + MO1-uchl3 Fig. 4 from Tse, 2017
MAP kinase activity increased occurrence, abnormal AB + MO1-uchl3 Fig. 5 from Tse, 2017
neuron hyperplastic, abnormal AB + MO1-uchl3 Fig. 1 with image from Tse et al., 2009
notochord malformed, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
pharyngeal arch sox9a expression decreased distribution, abnormal AB + MO1-uchl3 Fig. 5 from Tse, 2017
pharyngeal arch cartilage malformed, abnormal AB + MO1-uchl3 Fig. 4 from Tse, 2017
pigmentation decreased occurrence, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
trunk necrotic, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal AB + MO1-uchl3 Fig. S4 from Tse et al., 2009
Phenotype of all Fish created by or utilizing MO1-uchl3
Phenotype Fish Conditions Figures
notochord malformed, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal AB + MO1-uchl3 standard conditions Fig. 4 from Tse, 2017
trunk necrotic, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
ethmoid cartilage absent, abnormal AB + MO1-uchl3 standard conditions Fig. 4 from Tse, 2017
whole organism decreased size, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
pigmentation decreased occurrence, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal AB + MO1-uchl3 standard conditions Fig. 4 from Tse, 2017
pericardium edematous, abnormal AB + MO1-uchl3 standard conditions Fig. S4 from Tse et al., 2009
ethmoid cartilage sox9a expression decreased distribution, abnormal AB + MO1-uchl3 control Fig. 5 from Tse, 2017
pharyngeal arch sox9a expression decreased distribution, abnormal AB + MO1-uchl3 control Fig. 5 from Tse, 2017
neuron hyperplastic, abnormal AB + MO1-uchl3 standard conditions Fig. 1 with image from Tse et al., 2009
MAP kinase activity increased occurrence, abnormal AB + MO1-uchl3 standard conditions Fig. 5 from Tse, 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.