Morpholino

MO1-vcpip1

ID

ZDB-MRPHLNO-100225-23

Name

MO1-vcpip1

Previous Names

None

Target

Sequence

5' - GAGCCCGGAATCAACGACATAGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-vcpip1

No data available

Phenotype

Phenotype resulting from MO1-vcpip1

Phenotype	Fish	Figures
caudal fin upper lobe fused with caudal fin lower lobe, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
ethmoid cartilage absent, abnormal	AB + MO1-vcpip1	Fig. 4 from Tse, 2017
eye decreased size, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
head decreased size, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-vcpip1	Fig. 4 from Tse, 2017
notochord immature, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
notochord development disrupted, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-vcpip1	Fig. 4 from Tse, 2017
post-vent region curled, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
somite malformed, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
trunk immature, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal	AB + MO1-vcpip1	Fig. S4 from Tse et al., 2009

Phenotype of all Fish created by or utilizing MO1-vcpip1

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-vcpip1	standard conditions	Fig. 4 from Tse, 2017
trunk immature, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
ethmoid cartilage absent, abnormal	AB + MO1-vcpip1	standard conditions	Fig. 4 from Tse, 2017
notochord immature, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
somite malformed, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
caudal fin upper lobe fused with caudal fin lower lobe, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
notochord development disrupted, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
eye decreased size, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-vcpip1	standard conditions	Fig. 4 from Tse, 2017
whole organism decreased size, abnormal	AB + MO1-vcpip1	standard conditions	Fig. S4 from Tse et al., 2009

Citations