Morpholino

MO1-usp7

ID

ZDB-MRPHLNO-100215-10

Name

MO1-usp7

Previous Names

None

Target

Sequence

5' - CTGGGCTCTTTGTCTCCCTCGGGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-usp7

No data available

Phenotype

Phenotype resulting from MO1-usp7

Phenotype	Fish	Figures
caudal fin deformed, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
caudal fin upper lobe fused with caudal fin lower lobe, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
eye decreased size, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
head decreased size, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-usp7	Fig. 2 from Tse, 2017
Meckel's cartilage morphology, abnormal	AB + MO1-usp7	Fig. 2 from Tse, 2017
notochord development disrupted, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
otolith morphogenesis disrupted, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-usp7	Fig. 2 from Tse, 2017
pigmentation decreased occurrence, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal	AB + MO1-usp7	Fig. S4 from Tse et al., 2009

Phenotype of all Fish created by or utilizing MO1-usp7

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
Meckel's cartilage morphology, abnormal	AB + MO1-usp7	standard conditions	Fig. 2 from Tse, 2017
pigmentation decreased occurrence, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
head decreased size, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
otolith morphogenesis disrupted, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
caudal fin deformed, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
caudal fin upper lobe fused with caudal fin lower lobe, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
notochord development disrupted, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-usp7	standard conditions	Fig. 2 from Tse, 2017
pharyngeal arch cartilage malformed, abnormal	AB + MO1-usp7	standard conditions	Fig. 2 from Tse, 2017
central nervous system necrotic, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009
eye decreased size, abnormal	AB + MO1-usp7	standard conditions	Fig. S4 from Tse et al., 2009

Citations