Morpholino

MO1-jupa

ID
ZDB-MRPHLNO-091103-3
Name
MO1-jupa
Previous Names
  • MO1-jup
Target
Sequence
5' - GAGCCTCTCCCATGTGCATTTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-jupa
Expressed Gene Anatomy Figures
bmp2b Fig. 7 with image from Martin et al., 2009
bmp4 Fig. 4 with image,  Fig. 7 with image from Martin et al., 2009
dharma Fig. 7 with image from Martin et al., 2009
jupa Fig. 1 with image from Martin et al., 2009
myh7 Fig. 4 with image from Martin et al., 2009
myl7 Fig. 4 with image from Martin et al., 2009
ndr1 Fig. 7 with image from Martin et al., 2009
nkx2.5 Fig. 4 with image from Martin et al., 2009
notch1b Fig. 4 with image from Martin et al., 2009
Phenotype
Phenotype resulting from MO1-jupa
Phenotype Fish Figures
atrioventricular valve development disrupted, abnormal AB + MO1-jupa Fig. 5 with image from Martin et al., 2009
blood circulation disrupted, abnormal AB + MO1-jupa Fig. 1 with image,  Fig. 6 with image from Martin et al., 2009
heart decreased size, abnormal AB + MO1-jupa Fig. 1 with image from Martin et al., 2009
heart edematous, abnormal AB + MO1-jupa Fig. 1 with image,  Fig. 2 with image from Martin et al., 2009
heart adherens junction composition, abnormal AB + MO1-jupa Fig. 8 with image from Martin et al., 2009
heart adherens junction decreased amount, abnormal AB + MO1-jupa Fig. 9 with image from Martin et al., 2009
heart cell-cell junction decreased amount, abnormal AB + MO1-jupa text only from Martin et al., 2009
heart cell-cell junction structure, abnormal AB + MO1-jupa Fig. 9 with image from Martin et al., 2009
heart desmosome decreased amount, abnormal AB + MO1-jupa Fig. 9 with image from Martin et al., 2009
heart endothelial cell morphology, abnormal AB + MO1-jupa Fig. 5 with image from Martin et al., 2009
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO1-jupa + MO4-tp53 Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle tight junction structure, abnormal AB + MO1-jupa + MO4-tp53 Fig. 5 with image from Dasgupta et al., 2018
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-jupa Fig. 1 with image from Martin et al., 2009
nucleate erythrocyte decreased amount, abnormal AB + MO1-jupa Fig. 6 with image from Martin et al., 2009
post-vent region kinked, abnormal AB + MO1-jupa Fig. 1 with image from Martin et al., 2009
Phenotype of all Fish created by or utilizing MO1-jupa
Phenotype Fish Conditions Figures
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-jupa standard conditions Fig. 1 with image from Martin et al., 2009
heart cell-cell junction structure, abnormal AB + MO1-jupa standard conditions Fig. 9 with image from Martin et al., 2009
heart edematous, abnormal AB + MO1-jupa standard conditions Fig. 1 with image,  Fig. 2 with image from Martin et al., 2009
heart decreased size, abnormal AB + MO1-jupa standard conditions Fig. 1 with image from Martin et al., 2009
blood circulation disrupted, abnormal AB + MO1-jupa standard conditions Fig. 1 with image,  Fig. 6 with image from Martin et al., 2009
heart endothelial cell morphology, abnormal AB + MO1-jupa standard conditions Fig. 5 with image from Martin et al., 2009
heart adherens junction composition, abnormal AB + MO1-jupa standard conditions Fig. 8 with image from Martin et al., 2009
post-vent region kinked, abnormal AB + MO1-jupa standard conditions Fig. 1 with image from Martin et al., 2009
heart cell-cell junction decreased amount, abnormal AB + MO1-jupa standard conditions text only from Martin et al., 2009
nucleate erythrocyte decreased amount, abnormal AB + MO1-jupa standard conditions Fig. 6 with image from Martin et al., 2009
heart desmosome decreased amount, abnormal AB + MO1-jupa standard conditions Fig. 9 with image from Martin et al., 2009
atrioventricular valve development disrupted, abnormal AB + MO1-jupa standard conditions Fig. 5 with image from Martin et al., 2009
heart adherens junction decreased amount, abnormal AB + MO1-jupa standard conditions Fig. 9 with image from Martin et al., 2009
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle tight junction structure, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.