Morpholino

MO1-igf2b

ID
ZDB-MRPHLNO-090929-3
Name
MO1-igf2b
Previous Names
  • 2bMO1 (1)
Target
Sequence
5' - GTTTTAGTTGGTCCTCCATGACAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-igf2b
No data available
Phenotype
Phenotype resulting from MO1-igf2b
Phenotype Fish Figures
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO1-igf2b Fig. 3 from White et al., 2009
dorsal/ventral axis specification disrupted, abnormal AB/TU + MO1-igf2b Fig. 3 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2b Fig. 3 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2b Fig. 3 from White et al., 2009
Phenotype of all Fish created by or utilizing MO1-igf2b
Phenotype Fish Conditions Figures
whole organism curved ventral, abnormal AB/TU + MO1-igf2b standard conditions Fig. 3 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2b standard conditions Fig. 3 from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO1-igf2b standard conditions Fig. 3 from White et al., 2009
dorsal/ventral axis specification disrupted, abnormal AB/TU + MO1-igf2b standard conditions Fig. 3 from White et al., 2009
renal system process disrupted, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 6 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions text only from White et al., 2009
pronephric duct medial side fused with pronephric duct medial side, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 6 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4,  text only from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4 from White et al., 2009
whole organism edematous, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 6 from White et al., 2009
forebrain morphology, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 5 from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions text only from White et al., 2009
notochord development delayed, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4 from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4 from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.