Morpholino
MO1-rhcgl1
- ID
- ZDB-MRPHLNO-090616-13
- Name
- MO1-rhcgl1
- Previous Names
- None
- Target
- Sequence
-
5' - TTGGTGTTTTTGACCATTTTTGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rhcgl1
Expressed Gene | Anatomy | Figures |
---|---|---|
aqp1a.1 |
Fig. 7
from Talbot et al., 2015 |
|
rhag |
Fig. 7
from Braun et al., 2009 |
|
rhbg |
Fig. 7
from Braun et al., 2009 |
|
rhcgl1 |
Fig. 7
from Braun et al., 2009 |
|
slc14a2 |
Fig. 7
from Braun et al., 2009 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-rhcgl1
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-rhcgl1
1 - 5 of 7 Show all
Citations
- Talbot, K., Kwong, R.W., Gilmour, K.M., Perry, S.F. (2015) The water channel aquaporin-1a1 facilitates movement of CO2 and ammonia in zebrafish (Danio rerio) larvae. The Journal of experimental biology. 218:3931-3940
- Kumai, Y., Nesan, D., Vijayan, M.M., and Perry, S.F. (2012) Cortisol regulates Na(+) uptake in zebrafish, Danio rerio, larvae via the glucocorticoid receptor. Molecular and Cellular Endocrinology. 364(1-2):113-125
- Kumai, Y., and Perry, S.F. (2011) Ammonia excretion via Rhcg1 facilitates Na+ uptake in larval zebrafish, Danio rerio, in acidic water. American journal of physiology. Regulatory, integrative and comparative physiology. 301(5):R1517-28
- Perry, S.F., Braun, M.H., Noland, M., Dawdy, J., and Walsh, P.J. (2010) Do zebrafish Rh proteins act as dual ammonia–CO2 channels?. Journal of experimental zoology. Part A, Ecological genetics and physiology. 313(9):618-621
- Braun, M.H., Steele, S.L., Ekker, M., and Perry, S.F. (2009) Nitrogen excretion in developing zebrafish (Danio rerio): A role for Rh proteins and urea transporters. American journal of physiology. Renal physiology. 296(5):F994-F1005
1 - 5 of 5
Show