Morpholino

MO1-gas8

ID

ZDB-MRPHLNO-090505-3

Name

MO1-gas8

Previous Names

None

Target

Sequence

5' - GCGACGATTTTCTTTTTGGTGGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gas8

Expressed Gene	Anatomy	Figures
nkx2.2a	floor plate hindbrain	Fig. 4, Fig. 5 from Evron et al., 2011
pax2a	midbrain hindbrain boundary optic stalk otic vesicle	Fig. 4, Fig. 5 from Evron et al., 2011
shha	floor plate notochord	Fig. 4 from Evron et al., 2011

Phenotype

Phenotype resulting from MO1-gas8

Phenotype	Fish	Figures
cilium or flagellum-dependent cell motility arrested, abnormal	WT + MO1-gas8	Fig. 3 from Colantonio et al., 2009
embryo development disrupted, abnormal	WT + MO1-gas8	Fig. 5 from Evron et al., 2011
head hydrocephalic, abnormal	WT + MO1-gas8	Fig. 4 from Evron et al., 2011 Fig. 2 from Colantonio et al., 2009
muscle pioneer decreased amount, abnormal	WT + MO1-gas8	Fig. 6, Fig. 7 from Evron et al., 2011
otolith morphology, abnormal	WT + MO1-gas8	Fig. 2 from Colantonio et al., 2009
pericardium edematous, abnormal	WT + MO1-gas8	Fig. 4 from Evron et al., 2011 Fig. 2 from Colantonio et al., 2009
slow muscle cell decreased amount, abnormal	WT + MO1-gas8	Fig. 6 from Evron et al., 2011
somite disorganized, abnormal	WT + MO1-gas8	Fig. 2 from Colantonio et al., 2009
somite malformed, abnormal	WT + MO1-gas8	Fig. 4 from Evron et al., 2011

Phenotype of all Fish created by or utilizing MO1-gas8

Phenotype	Fish	Conditions	Figures
embryo development disrupted, abnormal	WT + MO1-gas8	standard conditions	Fig. 5 from Evron et al., 2011
somite disorganized, abnormal	WT + MO1-gas8	standard conditions	Fig. 2 from Colantonio et al., 2009
otolith morphology, abnormal	WT + MO1-gas8	standard conditions	Fig. 2 from Colantonio et al., 2009
cilium or flagellum-dependent cell motility arrested, abnormal	WT + MO1-gas8	standard conditions	Fig. 3 from Colantonio et al., 2009
muscle pioneer decreased amount, abnormal	WT + MO1-gas8	standard conditions	Fig. 6, Fig. 7 from Evron et al., 2011
head hydrocephalic, abnormal	WT + MO1-gas8	standard conditions	Fig. 4 from Evron et al., 2011 Fig. 2 from Colantonio et al., 2009
somite malformed, abnormal	WT + MO1-gas8	standard conditions	Fig. 4 from Evron et al., 2011
slow muscle cell decreased amount, abnormal	WT + MO1-gas8	standard conditions	Fig. 6 from Evron et al., 2011
pericardium edematous, abnormal	WT + MO1-gas8	standard conditions	Fig. 4 from Evron et al., 2011 Fig. 2 from Colantonio et al., 2009
muscle pioneer decreased amount, abnormal	WT + MO1-gas8 + MO1-grk3	standard conditions	Fig. 7 from Evron et al., 2011

Citations