Morpholino

MO1-spns1

ID
ZDB-MRPHLNO-081229-2
Name
MO1-spns1
Previous Names
None
Target
Sequence
5' - ATCTGCTTGTGACATCACTGCTGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spns1
No data available
Phenotype
Phenotype resulting from MO1-spns1
Phenotype of all Fish created by or utilizing MO1-spns1
Phenotype Fish Conditions Figures
yolk physical object quality, abnormal WT + MO1-spns1 standard conditions Fig. S5 from He et al., 2022
whole organism decreased life span, abnormal WT + MO1-spns1 standard conditions Fig. 1Fig. 2 from Sasaki et al., 2017
Fig. 2 with image from Sasaki et al., 2014
whole organism lysophosphatidylcholine increased amount, abnormal WT + MO1-spns1 standard conditions Fig. S5 from He et al., 2022
cellular senescence increased magnitude, abnormal WT + MO1-spns1 standard conditions Fig. S2 with image from Kishi et al., 2008
yolk opaque, abnormal WT + MO1-spns1 standard conditions Fig. 2 from Sasaki et al., 2017
Fig. 2 with image from Sasaki et al., 2014
Fig. S2 with image from Kishi et al., 2008
whole organism lysophosphatidylethanolamine increased amount, abnormal WT + MO1-spns1 standard conditions Fig. S5 from He et al., 2022
yolk opaque, ameliorated atp6v0cahi1207Tg/hi1207Tg + MO1-spns1 control Fig. 2 from Sasaki et al., 2017
heart edematous, abnormal spns2ko157/+ + MO1-spns1 standard conditions Fig. S6 from Kawahara et al., 2009
caudal fin blistered, abnormal spns2ko157/ko157 + MO1-spns1 standard conditions Fig. S6 from Kawahara et al., 2009
heart bifurcated, abnormal spns2ko157/ko157 + MO1-spns1 standard conditions Fig. S6 from Kawahara et al., 2009
heart edematous, abnormal spns2ko157/ko157 + MO1-spns1 standard conditions Fig. S6 from Kawahara et al., 2009
whole organism decreased life span, ameliorated WT + MO1-atp6v0ca + MO1-spns1 control Fig. 1 from Sasaki et al., 2017
autophagosome maturation process quality, abnormal zf155Tg + MO1-spns1 standard conditions Fig. 3 with image from Sasaki et al., 2014
cell autophagosome accumulation cell perinuclear region of cytoplasm, abnormal zf155Tg + MO1-spns1 standard conditions Fig. 3 with imageFig. 4 with image from Sasaki et al., 2014
cellular senescence increased process quality, abnormal zf155Tg + MO1-spns1 standard conditions Fig. 4 with image from Sasaki et al., 2014
cell autolysosome accumulation cell perinuclear region of cytoplasm, abnormal zf155Tg + MO1-spns1 standard conditions Fig. 3 with imageFig. 4 with image from Sasaki et al., 2014
cell autophagosome accumulation cell perinuclear region of cytoplasm, abnormal zf155Tg + MO1-spns1 + MO4-tp53 standard conditions Fig. 4 with image from Sasaki et al., 2014
cellular senescence increased process quality, abnormal zf155Tg + MO1-spns1 + MO4-tp53 standard conditions Fig. 4 with image from Sasaki et al., 2014
cell autolysosome accumulation cell perinuclear region of cytoplasm, abnormal zf155Tg + MO1-spns1 + MO4-tp53 standard conditions Fig. 4 with image from Sasaki et al., 2014
cell autolysosome accumulation cell perinuclear region of cytoplasm, abnormal scf4Tg; zf155Tg + MO1-spns1 standard conditions Fig. 1 with image from Sasaki et al., 2014
autophagosome maturation process quality, abnormal scf4Tg; zf155Tg + MO1-spns1 standard conditions Fig. 1 with image from Sasaki et al., 2014
cell autophagosome accumulation cell perinuclear region of cytoplasm, abnormal scf4Tg; zf155Tg + MO1-spns1 standard conditions Fig. 1 with image from Sasaki et al., 2014
yolk opaque, abnormal scf4Tg; zf156Tg + MO1-spns1 standard conditions Fig. 3 with image from Sasaki et al., 2014
cell autophagosome accumulation cell perinuclear region of cytoplasm, abnormal scf4Tg; zf156Tg + MO1-spns1 standard conditions Fig. 3 with image from Sasaki et al., 2014
cell autolysosome accumulation cell perinuclear region of cytoplasm, abnormal scf4Tg; zf156Tg + MO1-spns1 standard conditions Fig. 3 with image from Sasaki et al., 2014
cellular senescence increased process quality, abnormal scf4Tg; zf156Tg + MO1-spns1 standard conditions Fig. 3 with image from Sasaki et al., 2014
autophagosome maturation process quality, abnormal scf4Tg; zf156Tg + MO1-spns1 standard conditions Fig. 3 with image from Sasaki et al., 2014
Citations